Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017098057:

Variant ID: vg1017098057 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 17098057
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGACTGAGTGCTACCCACTGTACTCAGCAAGTCATACCGGAATAGGGGTATGATGAAGGGAATTATCAAAGGAGAGCTAGAGTGGTTCATTTGCATAAAG[T/C]
GAGCATTTATAAACAGAAGTTGAAAGAATTAAACAGTTGTAATAATTAATCATATTATTCATCCACTGTCCAACGCTATACCACGTTGCGACAGGCCCAA

Reverse complement sequence

TTGGGCCTGTCGCAACGTGGTATAGCGTTGGACAGTGGATGAATAATATGATTAATTATTACAACTGTTTAATTCTTTCAACTTCTGTTTATAAATGCTC[A/G]
CTTTATGCAAATGAACCACTCTAGCTCTCCTTTGATAATTCCCTTCATCATACCCCTATTCCGGTATGACTTGCTGAGTACAGTGGGTAGCACTCAGTCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.70%	0.20%	5.88%	65.30%	NA
All Indica	2759	3.90%	0.10%	4.31%	91.70%	NA
All Japonica	1512	79.10%	0.00%	7.87%	13.03%	NA
Aus	269	4.10%	1.50%	1.86%	92.57%	NA
Indica I	595	3.40%	0.20%	8.24%	88.24%	NA
Indica II	465	5.60%	0.20%	4.95%	89.25%	NA
Indica III	913	2.80%	0.00%	1.64%	95.51%	NA
Indica Intermediate	786	4.50%	0.10%	4.07%	91.35%	NA
Temperate Japonica	767	96.30%	0.00%	1.43%	2.22%	NA
Tropical Japonica	504	62.10%	0.00%	17.66%	20.24%	NA
Japonica Intermediate	241	59.80%	0.00%	7.88%	32.37%	NA
VI/Aromatic	96	4.20%	1.00%	23.96%	70.83%	NA
Intermediate	90	40.00%	0.00%	13.33%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1017098057	T -> C	LOC_Os10g32630.1	upstream_gene_variant ; 3595.0bp to feature; MODIFIER	silent_mutation	Average:12.516; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg1017098057	T -> C	LOC_Os10g32649.1	downstream_gene_variant ; 2842.0bp to feature; MODIFIER	silent_mutation	Average:12.516; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg1017098057	T -> C	LOC_Os10g32640.1	intron_variant ; MODIFIER	silent_mutation	Average:12.516; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg1017098057	T -> DEL	N	N	silent_mutation	Average:12.516; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1017098057	NA	4.01E-08	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	1.30E-08	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	3.45E-07	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	2.59E-06	2.59E-06	mr1046	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	4.54E-06	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	5.73E-07	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	1.90E-08	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	3.45E-06	mr1153	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	4.74E-06	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	3.28E-06	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	3.39E-06	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	9.26E-07	9.26E-07	mr1270	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	6.60E-06	mr1283	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	6.02E-06	6.02E-06	mr1288	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	9.10E-06	9.10E-06	mr1307	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	5.79E-07	mr1314	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	1.09E-06	1.09E-06	mr1353	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	8.27E-07	8.27E-07	mr1356	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	8.50E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	1.04E-09	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	2.72E-08	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	8.22E-06	mr1433	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	5.57E-06	mr1433	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	5.22E-07	5.22E-07	mr1442	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	2.32E-09	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	8.73E-08	1.05E-08	mr1511	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	9.15E-06	4.37E-06	mr1564	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	1.98E-07	mr1571	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	1.87E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	2.49E-07	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	5.78E-06	mr1651	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	3.43E-08	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	3.07E-07	4.17E-09	mr1716	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	3.28E-06	mr1948	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	2.94E-06	2.94E-06	mr1948	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	1.65E-08	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	6.77E-06	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	9.55E-06	mr1570_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017098057	NA	7.70E-06	mr1951_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251