\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017039650:

Variant ID: vg1017039650 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17039650
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAGGGGGGGTGCCTGACTTTTTCCCTCTCCCCGGGCGCCAGCGAGCAATTCCGATTAAAAATTATCCATTAAAAAATATTTGTTAAAATTTACTTATTT[C/T]
GGAATATTATAGTGATAAATAACACCATTAAAATTAAGTTGTTTAAAAAATATATATCTTAAAATACAAATGTAAGTTAGGTTAATTAGTAGATATTATT

Reverse complement sequence

AATAATATCTACTAATTAACCTAACTTACATTTGTATTTTAAGATATATATTTTTTAAACAACTTAATTTTAATGGTGTTATTTATCACTATAATATTCC[G/A]
AAATAAGTAAATTTTAACAAATATTTTTTAATGGATAATTTTTAATCGGAATTGCTCGCTGGCGCCCGGGGAGAGGGAAAAAGTCAGGCACCCCCCCTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.20% 5.40% 0.47% 0.00% NA
All Indica  2759 90.80% 8.80% 0.40% 0.00% NA
All Japonica  1512 99.50% 0.40% 0.13% 0.00% NA
Aus  269 97.00% 0.00% 2.97% 0.00% NA
Indica I  595 82.00% 17.60% 0.34% 0.00% NA
Indica II  465 91.80% 7.70% 0.43% 0.00% NA
Indica III  913 96.20% 3.70% 0.11% 0.00% NA
Indica Intermediate  786 90.60% 8.70% 0.76% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 0.80% 0.40% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017039650 C -> T LOC_Os10g32520.1 upstream_gene_variant ; 4494.0bp to feature; MODIFIER silent_mutation Average:65.527; most accessible tissue: Zhenshan97 root, score: 86.252 N N N N
vg1017039650 C -> T LOC_Os10g32540.1 upstream_gene_variant ; 392.0bp to feature; MODIFIER silent_mutation Average:65.527; most accessible tissue: Zhenshan97 root, score: 86.252 N N N N
vg1017039650 C -> T LOC_Os10g32520.4 upstream_gene_variant ; 4494.0bp to feature; MODIFIER silent_mutation Average:65.527; most accessible tissue: Zhenshan97 root, score: 86.252 N N N N
vg1017039650 C -> T LOC_Os10g32520.3 upstream_gene_variant ; 4494.0bp to feature; MODIFIER silent_mutation Average:65.527; most accessible tissue: Zhenshan97 root, score: 86.252 N N N N
vg1017039650 C -> T LOC_Os10g32520.2 upstream_gene_variant ; 4494.0bp to feature; MODIFIER silent_mutation Average:65.527; most accessible tissue: Zhenshan97 root, score: 86.252 N N N N
vg1017039650 C -> T LOC_Os10g32520-LOC_Os10g32540 intergenic_region ; MODIFIER silent_mutation Average:65.527; most accessible tissue: Zhenshan97 root, score: 86.252 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017039650 NA 7.58E-07 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017039650 NA 4.25E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017039650 NA 7.67E-08 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017039650 NA 1.36E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017039650 NA 5.31E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017039650 NA 6.44E-07 mr1571 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017039650 2.00E-06 NA mr1716 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017039650 3.90E-06 5.55E-08 mr1716 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017039650 NA 1.40E-06 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017039650 NA 2.31E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017039650 NA 3.38E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017039650 NA 5.86E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251