| Variant ID: vg1017039650 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 17039650 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGAGGGGGGGTGCCTGACTTTTTCCCTCTCCCCGGGCGCCAGCGAGCAATTCCGATTAAAAATTATCCATTAAAAAATATTTGTTAAAATTTACTTATTT[C/T]
GGAATATTATAGTGATAAATAACACCATTAAAATTAAGTTGTTTAAAAAATATATATCTTAAAATACAAATGTAAGTTAGGTTAATTAGTAGATATTATT
AATAATATCTACTAATTAACCTAACTTACATTTGTATTTTAAGATATATATTTTTTAAACAACTTAATTTTAATGGTGTTATTTATCACTATAATATTCC[G/A]
AAATAAGTAAATTTTAACAAATATTTTTTAATGGATAATTTTTAATCGGAATTGCTCGCTGGCGCCCGGGGAGAGGGAAAAAGTCAGGCACCCCCCCTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.20% | 5.40% | 0.47% | 0.00% | NA |
| All Indica | 2759 | 90.80% | 8.80% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Aus | 269 | 97.00% | 0.00% | 2.97% | 0.00% | NA |
| Indica I | 595 | 82.00% | 17.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 91.80% | 7.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 96.20% | 3.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 90.60% | 8.70% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 0.80% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1017039650 | C -> T | LOC_Os10g32520.1 | upstream_gene_variant ; 4494.0bp to feature; MODIFIER | silent_mutation | Average:65.527; most accessible tissue: Zhenshan97 root, score: 86.252 | N | N | N | N |
| vg1017039650 | C -> T | LOC_Os10g32540.1 | upstream_gene_variant ; 392.0bp to feature; MODIFIER | silent_mutation | Average:65.527; most accessible tissue: Zhenshan97 root, score: 86.252 | N | N | N | N |
| vg1017039650 | C -> T | LOC_Os10g32520.4 | upstream_gene_variant ; 4494.0bp to feature; MODIFIER | silent_mutation | Average:65.527; most accessible tissue: Zhenshan97 root, score: 86.252 | N | N | N | N |
| vg1017039650 | C -> T | LOC_Os10g32520.3 | upstream_gene_variant ; 4494.0bp to feature; MODIFIER | silent_mutation | Average:65.527; most accessible tissue: Zhenshan97 root, score: 86.252 | N | N | N | N |
| vg1017039650 | C -> T | LOC_Os10g32520.2 | upstream_gene_variant ; 4494.0bp to feature; MODIFIER | silent_mutation | Average:65.527; most accessible tissue: Zhenshan97 root, score: 86.252 | N | N | N | N |
| vg1017039650 | C -> T | LOC_Os10g32520-LOC_Os10g32540 | intergenic_region ; MODIFIER | silent_mutation | Average:65.527; most accessible tissue: Zhenshan97 root, score: 86.252 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1017039650 | NA | 7.58E-07 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017039650 | NA | 4.25E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017039650 | NA | 7.67E-08 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017039650 | NA | 1.36E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017039650 | NA | 5.31E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017039650 | NA | 6.44E-07 | mr1571 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017039650 | 2.00E-06 | NA | mr1716 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017039650 | 3.90E-06 | 5.55E-08 | mr1716 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017039650 | NA | 1.40E-06 | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017039650 | NA | 2.31E-06 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017039650 | NA | 3.38E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017039650 | NA | 5.86E-06 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |