\
| Variant ID: vg1017033032 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 17033032 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 124. )
GGGTGAAGACTATTTTAATCTTATTATTGTTATATGGTTTAGTTAAGATAAAATTCACTGTGTTAAATTTGCTTGGATATATATTTTGTTAGAAAATCAT[G/A]
AGCTGCAATTAGGAGTCCGATCGTCTCAAATTAGCATGCGAGTTTTTTAAAGAGATTTCTTATATGATTCCTTCTGTATTTTCAAAAGCGAACGAATTCA
TGAATTCGTTCGCTTTTGAAAATACAGAAGGAATCATATAAGAAATCTCTTTAAAAAACTCGCATGCTAATTTGAGACGATCGGACTCCTAATTGCAGCT[C/T]
ATGATTTTCTAACAAAATATATATCCAAGCAAATTTAACACAGTGAATTTTATCTTAACTAAACCATATAACAATAATAAGATTAAAATAGTCTTCACCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.90% | 3.80% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 93.20% | 6.20% | 0.54% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.00% | 14.60% | 1.34% | 0.00% | NA |
| Indica II | 465 | 92.50% | 7.10% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.10% | 6.20% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1017033032 | G -> A | LOC_Os10g32520.2 | downstream_gene_variant ; 725.0bp to feature; MODIFIER | silent_mutation | Average:44.805; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg1017033032 | G -> A | LOC_Os10g32520.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.805; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg1017033032 | G -> A | LOC_Os10g32520.4 | intron_variant ; MODIFIER | silent_mutation | Average:44.805; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg1017033032 | G -> A | LOC_Os10g32520.3 | intron_variant ; MODIFIER | silent_mutation | Average:44.805; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1017033032 | NA | 3.45E-07 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017033032 | NA | 7.03E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017033032 | NA | 2.25E-08 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017033032 | NA | 2.00E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017033032 | NA | 1.09E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017033032 | 7.83E-06 | NA | mr1571 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017033032 | NA | 4.41E-06 | mr1571 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017033032 | NA | 2.64E-06 | mr1716 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017033032 | 6.83E-06 | 4.61E-07 | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017033032 | NA | 5.84E-06 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017033032 | NA | 2.11E-06 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017033032 | NA | 2.98E-06 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |