\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017033032:

Variant ID: vg1017033032 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17033032
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


GGGTGAAGACTATTTTAATCTTATTATTGTTATATGGTTTAGTTAAGATAAAATTCACTGTGTTAAATTTGCTTGGATATATATTTTGTTAGAAAATCAT[G/A]
AGCTGCAATTAGGAGTCCGATCGTCTCAAATTAGCATGCGAGTTTTTTAAAGAGATTTCTTATATGATTCCTTCTGTATTTTCAAAAGCGAACGAATTCA

Reverse complement sequence

TGAATTCGTTCGCTTTTGAAAATACAGAAGGAATCATATAAGAAATCTCTTTAAAAAACTCGCATGCTAATTTGAGACGATCGGACTCCTAATTGCAGCT[C/T]
ATGATTTTCTAACAAAATATATATCCAAGCAAATTTAACACAGTGAATTTTATCTTAACTAAACCATATAACAATAATAAGATTAAAATAGTCTTCACCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.90% 3.80% 0.32% 0.00% NA
All Indica  2759 93.20% 6.20% 0.54% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 84.00% 14.60% 1.34% 0.00% NA
Indica II  465 92.50% 7.10% 0.43% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 93.10% 6.20% 0.64% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017033032 G -> A LOC_Os10g32520.2 downstream_gene_variant ; 725.0bp to feature; MODIFIER silent_mutation Average:44.805; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg1017033032 G -> A LOC_Os10g32520.1 intron_variant ; MODIFIER silent_mutation Average:44.805; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg1017033032 G -> A LOC_Os10g32520.4 intron_variant ; MODIFIER silent_mutation Average:44.805; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg1017033032 G -> A LOC_Os10g32520.3 intron_variant ; MODIFIER silent_mutation Average:44.805; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017033032 NA 3.45E-07 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017033032 NA 7.03E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017033032 NA 2.25E-08 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017033032 NA 2.00E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017033032 NA 1.09E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017033032 7.83E-06 NA mr1571 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017033032 NA 4.41E-06 mr1571 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017033032 NA 2.64E-06 mr1716 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017033032 6.83E-06 4.61E-07 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017033032 NA 5.84E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017033032 NA 2.11E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017033032 NA 2.98E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251