\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017014524:

Variant ID: vg1017014524 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17014524
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, C: 0.27, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GTCTCTGTTGAGGAGCCACAAGGGCCGGGCCTATTTCAACCCTTTCCTCACGAGGTTGCACAAATGCACTCCTCAGTTTCACTCTTAATTTCTTCCCTTG[T/C]
GGAGGCAAAATCGAAGCCTTCACAAACTTTCTTGATTTCTTCCCTTGCGGATACGAAATCGAAGGCTTCACAAACTTTTCGTGGCACACCACAACCTTGG

Reverse complement sequence

CCAAGGTTGTGGTGTGCCACGAAAAGTTTGTGAAGCCTTCGATTTCGTATCCGCAAGGGAAGAAATCAAGAAAGTTTGTGAAGGCTTCGATTTTGCCTCC[A/G]
CAAGGGAAGAAATTAAGAGTGAAACTGAGGAGTGCATTTGTGCAACCTCGTGAGGAAAGGGTTGAAATAGGCCCGGCCCTTGTGGCTCCTCAACAGAGAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 20.20% 16.40% 0.40% 62.97% NA
All Indica  2759 1.70% 8.00% 0.65% 89.67% NA
All Japonica  1512 58.70% 33.60% 0.00% 7.74% NA
Aus  269 0.00% 0.40% 0.37% 99.26% NA
Indica I  595 1.50% 17.30% 1.85% 79.33% NA
Indica II  465 3.20% 9.70% 0.00% 87.10% NA
Indica III  913 0.70% 0.70% 0.33% 98.36% NA
Indica Intermediate  786 2.20% 8.40% 0.51% 88.93% NA
Temperate Japonica  767 95.70% 2.70% 0.00% 1.56% NA
Tropical Japonica  504 8.50% 84.50% 0.00% 6.94% NA
Japonica Intermediate  241 45.60% 25.30% 0.00% 29.05% NA
VI/Aromatic  96 1.00% 26.00% 0.00% 72.92% NA
Intermediate  90 24.40% 22.20% 0.00% 53.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017014524 T -> C LOC_Os10g32470.1 upstream_gene_variant ; 3509.0bp to feature; MODIFIER silent_mutation Average:25.011; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1017014524 T -> C LOC_Os10g32500.1 upstream_gene_variant ; 4398.0bp to feature; MODIFIER silent_mutation Average:25.011; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1017014524 T -> C LOC_Os10g32470-LOC_Os10g32500 intergenic_region ; MODIFIER silent_mutation Average:25.011; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1017014524 T -> DEL N N silent_mutation Average:25.011; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017014524 NA 2.86E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 3.93E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 3.44E-19 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 3.21E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 4.19E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 1.49E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 2.36E-06 NA mr1213 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 4.38E-06 mr1263 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 3.37E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 1.77E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 4.38E-06 mr1451 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 2.45E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 2.35E-11 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 7.98E-12 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 1.83E-15 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 1.50E-14 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 1.34E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 1.62E-09 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 2.56E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 4.42E-15 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 4.39E-08 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 8.83E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 5.96E-07 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 6.85E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 4.69E-06 1.48E-10 mr1927 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 4.01E-11 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 1.71E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017014524 NA 9.70E-13 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251