\
| Variant ID: vg1017014524 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 17014524 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, C: 0.27, others allele: 0.00, population size: 103. )
GTCTCTGTTGAGGAGCCACAAGGGCCGGGCCTATTTCAACCCTTTCCTCACGAGGTTGCACAAATGCACTCCTCAGTTTCACTCTTAATTTCTTCCCTTG[T/C]
GGAGGCAAAATCGAAGCCTTCACAAACTTTCTTGATTTCTTCCCTTGCGGATACGAAATCGAAGGCTTCACAAACTTTTCGTGGCACACCACAACCTTGG
CCAAGGTTGTGGTGTGCCACGAAAAGTTTGTGAAGCCTTCGATTTCGTATCCGCAAGGGAAGAAATCAAGAAAGTTTGTGAAGGCTTCGATTTTGCCTCC[A/G]
CAAGGGAAGAAATTAAGAGTGAAACTGAGGAGTGCATTTGTGCAACCTCGTGAGGAAAGGGTTGAAATAGGCCCGGCCCTTGTGGCTCCTCAACAGAGAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 20.20% | 16.40% | 0.40% | 62.97% | NA |
| All Indica | 2759 | 1.70% | 8.00% | 0.65% | 89.67% | NA |
| All Japonica | 1512 | 58.70% | 33.60% | 0.00% | 7.74% | NA |
| Aus | 269 | 0.00% | 0.40% | 0.37% | 99.26% | NA |
| Indica I | 595 | 1.50% | 17.30% | 1.85% | 79.33% | NA |
| Indica II | 465 | 3.20% | 9.70% | 0.00% | 87.10% | NA |
| Indica III | 913 | 0.70% | 0.70% | 0.33% | 98.36% | NA |
| Indica Intermediate | 786 | 2.20% | 8.40% | 0.51% | 88.93% | NA |
| Temperate Japonica | 767 | 95.70% | 2.70% | 0.00% | 1.56% | NA |
| Tropical Japonica | 504 | 8.50% | 84.50% | 0.00% | 6.94% | NA |
| Japonica Intermediate | 241 | 45.60% | 25.30% | 0.00% | 29.05% | NA |
| VI/Aromatic | 96 | 1.00% | 26.00% | 0.00% | 72.92% | NA |
| Intermediate | 90 | 24.40% | 22.20% | 0.00% | 53.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1017014524 | T -> C | LOC_Os10g32470.1 | upstream_gene_variant ; 3509.0bp to feature; MODIFIER | silent_mutation | Average:25.011; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg1017014524 | T -> C | LOC_Os10g32500.1 | upstream_gene_variant ; 4398.0bp to feature; MODIFIER | silent_mutation | Average:25.011; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg1017014524 | T -> C | LOC_Os10g32470-LOC_Os10g32500 | intergenic_region ; MODIFIER | silent_mutation | Average:25.011; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg1017014524 | T -> DEL | N | N | silent_mutation | Average:25.011; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1017014524 | NA | 2.86E-13 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 3.93E-07 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 3.44E-19 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 3.21E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 4.19E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 1.49E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | 2.36E-06 | NA | mr1213 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 4.38E-06 | mr1263 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 3.37E-07 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 1.77E-08 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 4.38E-06 | mr1451 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 2.45E-06 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 2.35E-11 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 7.98E-12 | mr1539 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 1.83E-15 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 1.50E-14 | mr1540 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 1.34E-06 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 1.62E-09 | mr1580 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 2.56E-08 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 4.42E-15 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 4.39E-08 | mr1733 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 8.83E-09 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 5.96E-07 | mr1826 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 6.85E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | 4.69E-06 | 1.48E-10 | mr1927 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 4.01E-11 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 1.71E-07 | mr1156_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017014524 | NA | 9.70E-13 | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |