\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017000481:

Variant ID: vg1017000481 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17000481
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGGGGTGTCCCATTCCACCCATGTGGCCGCACTTGTCTTATGTTCGGATGTAATTCCAAGGAAACGATCCTTAAGTGCAAGAGCGGGAGACTGTACACC[T/C]
GGTACGTTCCCCGGTCCTCGATTTTGGAAATTCATTTAGTTCGCAAGTACCGACCCAGGTGTCGGGTTTTCCAAGTCTTTTGTAAAACCCAAGTTTTACC

Reverse complement sequence

GGTAAAACTTGGGTTTTACAAAAGACTTGGAAAACCCGACACCTGGGTCGGTACTTGCGAACTAAATGAATTTCCAAAATCGAGGACCGGGGAACGTACC[A/G]
GGTGTACAGTCTCCCGCTCTTGCACTTAAGGATCGTTTCCTTGGAATTACATCCGAACATAAGACAAGTGCGGCCACATGGGTGGAATGGGACACCCCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.50% 4.50% 14.64% 55.33% NA
All Indica  2759 1.20% 0.50% 13.81% 84.49% NA
All Japonica  1512 75.60% 12.60% 4.43% 7.34% NA
Aus  269 0.40% 0.40% 60.97% 38.29% NA
Indica I  595 0.70% 0.30% 11.09% 87.90% NA
Indica II  465 3.00% 1.10% 7.31% 88.60% NA
Indica III  913 0.10% 0.10% 21.91% 77.88% NA
Indica Intermediate  786 1.90% 0.60% 10.31% 87.15% NA
Temperate Japonica  767 68.40% 23.90% 6.13% 1.56% NA
Tropical Japonica  504 92.30% 0.00% 1.79% 5.95% NA
Japonica Intermediate  241 63.50% 3.30% 4.56% 28.63% NA
VI/Aromatic  96 2.10% 0.00% 68.75% 29.17% NA
Intermediate  90 30.00% 7.80% 15.56% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017000481 T -> C LOC_Os10g32420.1 upstream_gene_variant ; 1336.0bp to feature; MODIFIER silent_mutation Average:20.6; most accessible tissue: Callus, score: 25.795 N N N N
vg1017000481 T -> C LOC_Os10g32420-LOC_Os10g32444 intergenic_region ; MODIFIER silent_mutation Average:20.6; most accessible tissue: Callus, score: 25.795 N N N N
vg1017000481 T -> DEL N N silent_mutation Average:20.6; most accessible tissue: Callus, score: 25.795 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017000481 NA 3.42E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1017000481 NA 1.01E-06 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017000481 NA 4.51E-07 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017000481 NA 1.17E-07 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017000481 NA 1.41E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017000481 NA 2.30E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017000481 NA 5.54E-07 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017000481 2.22E-06 5.16E-11 mr1354_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017000481 NA 1.16E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251