Variant ID: vg1017000481 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 17000481 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAGGGGTGTCCCATTCCACCCATGTGGCCGCACTTGTCTTATGTTCGGATGTAATTCCAAGGAAACGATCCTTAAGTGCAAGAGCGGGAGACTGTACACC[T/C]
GGTACGTTCCCCGGTCCTCGATTTTGGAAATTCATTTAGTTCGCAAGTACCGACCCAGGTGTCGGGTTTTCCAAGTCTTTTGTAAAACCCAAGTTTTACC
GGTAAAACTTGGGTTTTACAAAAGACTTGGAAAACCCGACACCTGGGTCGGTACTTGCGAACTAAATGAATTTCCAAAATCGAGGACCGGGGAACGTACC[A/G]
GGTGTACAGTCTCCCGCTCTTGCACTTAAGGATCGTTTCCTTGGAATTACATCCGAACATAAGACAAGTGCGGCCACATGGGTGGAATGGGACACCCCTG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 25.50% | 4.50% | 14.64% | 55.33% | NA |
All Indica | 2759 | 1.20% | 0.50% | 13.81% | 84.49% | NA |
All Japonica | 1512 | 75.60% | 12.60% | 4.43% | 7.34% | NA |
Aus | 269 | 0.40% | 0.40% | 60.97% | 38.29% | NA |
Indica I | 595 | 0.70% | 0.30% | 11.09% | 87.90% | NA |
Indica II | 465 | 3.00% | 1.10% | 7.31% | 88.60% | NA |
Indica III | 913 | 0.10% | 0.10% | 21.91% | 77.88% | NA |
Indica Intermediate | 786 | 1.90% | 0.60% | 10.31% | 87.15% | NA |
Temperate Japonica | 767 | 68.40% | 23.90% | 6.13% | 1.56% | NA |
Tropical Japonica | 504 | 92.30% | 0.00% | 1.79% | 5.95% | NA |
Japonica Intermediate | 241 | 63.50% | 3.30% | 4.56% | 28.63% | NA |
VI/Aromatic | 96 | 2.10% | 0.00% | 68.75% | 29.17% | NA |
Intermediate | 90 | 30.00% | 7.80% | 15.56% | 46.67% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1017000481 | T -> C | LOC_Os10g32420.1 | upstream_gene_variant ; 1336.0bp to feature; MODIFIER | silent_mutation | Average:20.6; most accessible tissue: Callus, score: 25.795 | N | N | N | N |
vg1017000481 | T -> C | LOC_Os10g32420-LOC_Os10g32444 | intergenic_region ; MODIFIER | silent_mutation | Average:20.6; most accessible tissue: Callus, score: 25.795 | N | N | N | N |
vg1017000481 | T -> DEL | N | N | silent_mutation | Average:20.6; most accessible tissue: Callus, score: 25.795 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1017000481 | NA | 3.42E-10 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg1017000481 | NA | 1.01E-06 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1017000481 | NA | 4.51E-07 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1017000481 | NA | 1.17E-07 | mr1902 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1017000481 | NA | 1.41E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1017000481 | NA | 2.30E-07 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1017000481 | NA | 5.54E-07 | mr1138_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1017000481 | 2.22E-06 | 5.16E-11 | mr1354_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1017000481 | NA | 1.16E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |