| Variant ID: vg1016932373 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 16932373 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 123. )
GCCCGATGATCCCTTACCCTAATGACACCTAGCGTTGAAACCTATCCTCATGTCCCTTTACGCCGTCCTGACAAGGCCTCCGAGGAACCTAAGGGATCTT[C/T]
AGCTGGGGACGCCCAGAGCCGATAAGGCCTTGTCAGATCCTGTAGAGACGAAAGACCATGCAAGATCTAGTCGTCTAAGAGTTCTCGCCGTGCGTATTAA
TTAATACGCACGGCGAGAACTCTTAGACGACTAGATCTTGCATGGTCTTTCGTCTCTACAGGATCTGACAAGGCCTTATCGGCTCTGGGCGTCCCCAGCT[G/A]
AAGATCCCTTAGGTTCCTCGGAGGCCTTGTCAGGACGGCGTAAAGGGACATGAGGATAGGTTTCAACGCTAGGTGTCATTAGGGTAAGGGATCATCGGGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.20% | 45.50% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 28.00% | 71.50% | 0.54% | 0.00% | NA |
| All Japonica | 1512 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 86.60% | 13.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 32.80% | 66.20% | 1.01% | 0.00% | NA |
| Indica II | 465 | 21.50% | 77.40% | 1.08% | 0.00% | NA |
| Indica III | 913 | 26.10% | 73.70% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 30.40% | 69.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.80% | 28.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 34.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1016932373 | C -> T | LOC_Os10g32240.1 | downstream_gene_variant ; 3370.0bp to feature; MODIFIER | silent_mutation | Average:31.885; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg1016932373 | C -> T | LOC_Os10g32250.1 | downstream_gene_variant ; 520.0bp to feature; MODIFIER | silent_mutation | Average:31.885; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg1016932373 | C -> T | LOC_Os10g32260.1 | downstream_gene_variant ; 434.0bp to feature; MODIFIER | silent_mutation | Average:31.885; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg1016932373 | C -> T | LOC_Os10g32250-LOC_Os10g32260 | intergenic_region ; MODIFIER | silent_mutation | Average:31.885; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1016932373 | NA | 1.52E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016932373 | NA | 1.44E-10 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016932373 | NA | 2.81E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016932373 | NA | 3.25E-06 | mr1358 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016932373 | NA | 9.05E-06 | mr1571 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016932373 | NA | 1.97E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016932373 | NA | 1.08E-07 | mr1498_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016932373 | NA | 1.30E-08 | mr1925_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |