Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1016932373:

Variant ID: vg1016932373 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16932373
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

GCCCGATGATCCCTTACCCTAATGACACCTAGCGTTGAAACCTATCCTCATGTCCCTTTACGCCGTCCTGACAAGGCCTCCGAGGAACCTAAGGGATCTT[C/T]
AGCTGGGGACGCCCAGAGCCGATAAGGCCTTGTCAGATCCTGTAGAGACGAAAGACCATGCAAGATCTAGTCGTCTAAGAGTTCTCGCCGTGCGTATTAA

Reverse complement sequence

TTAATACGCACGGCGAGAACTCTTAGACGACTAGATCTTGCATGGTCTTTCGTCTCTACAGGATCTGACAAGGCCTTATCGGCTCTGGGCGTCCCCAGCT[G/A]
AAGATCCCTTAGGTTCCTCGGAGGCCTTGTCAGGACGGCGTAAAGGGACATGAGGATAGGTTTCAACGCTAGGTGTCATTAGGGTAAGGGATCATCGGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.20%	45.50%	0.32%	0.00%	NA
All Indica	2759	28.00%	71.50%	0.54%	0.00%	NA
All Japonica	1512	92.90%	7.10%	0.00%	0.00%	NA
Aus	269	86.60%	13.40%	0.00%	0.00%	NA
Indica I	595	32.80%	66.20%	1.01%	0.00%	NA
Indica II	465	21.50%	77.40%	1.08%	0.00%	NA
Indica III	913	26.10%	73.70%	0.22%	0.00%	NA
Indica Intermediate	786	30.40%	69.30%	0.25%	0.00%	NA
Temperate Japonica	767	98.30%	1.70%	0.00%	0.00%	NA
Tropical Japonica	504	94.80%	5.20%	0.00%	0.00%	NA
Japonica Intermediate	241	71.80%	28.20%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	65.60%	34.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016932373	C -> T	LOC_Os10g32240.1	downstream_gene_variant ; 3370.0bp to feature; MODIFIER	silent_mutation	Average:31.885; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg1016932373	C -> T	LOC_Os10g32250.1	downstream_gene_variant ; 520.0bp to feature; MODIFIER	silent_mutation	Average:31.885; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg1016932373	C -> T	LOC_Os10g32260.1	downstream_gene_variant ; 434.0bp to feature; MODIFIER	silent_mutation	Average:31.885; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg1016932373	C -> T	LOC_Os10g32250-LOC_Os10g32260	intergenic_region ; MODIFIER	silent_mutation	Average:31.885; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016932373	NA	1.52E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016932373	NA	1.44E-10	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016932373	NA	2.81E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016932373	NA	3.25E-06	mr1358	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016932373	NA	9.05E-06	mr1571	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016932373	NA	1.97E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016932373	NA	1.08E-07	mr1498_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016932373	NA	1.30E-08	mr1925_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251