\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016932373:

Variant ID: vg1016932373 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16932373
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


GCCCGATGATCCCTTACCCTAATGACACCTAGCGTTGAAACCTATCCTCATGTCCCTTTACGCCGTCCTGACAAGGCCTCCGAGGAACCTAAGGGATCTT[C/T]
AGCTGGGGACGCCCAGAGCCGATAAGGCCTTGTCAGATCCTGTAGAGACGAAAGACCATGCAAGATCTAGTCGTCTAAGAGTTCTCGCCGTGCGTATTAA

Reverse complement sequence

TTAATACGCACGGCGAGAACTCTTAGACGACTAGATCTTGCATGGTCTTTCGTCTCTACAGGATCTGACAAGGCCTTATCGGCTCTGGGCGTCCCCAGCT[G/A]
AAGATCCCTTAGGTTCCTCGGAGGCCTTGTCAGGACGGCGTAAAGGGACATGAGGATAGGTTTCAACGCTAGGTGTCATTAGGGTAAGGGATCATCGGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.20% 45.50% 0.32% 0.00% NA
All Indica  2759 28.00% 71.50% 0.54% 0.00% NA
All Japonica  1512 92.90% 7.10% 0.00% 0.00% NA
Aus  269 86.60% 13.40% 0.00% 0.00% NA
Indica I  595 32.80% 66.20% 1.01% 0.00% NA
Indica II  465 21.50% 77.40% 1.08% 0.00% NA
Indica III  913 26.10% 73.70% 0.22% 0.00% NA
Indica Intermediate  786 30.40% 69.30% 0.25% 0.00% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 94.80% 5.20% 0.00% 0.00% NA
Japonica Intermediate  241 71.80% 28.20% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016932373 C -> T LOC_Os10g32240.1 downstream_gene_variant ; 3370.0bp to feature; MODIFIER silent_mutation Average:31.885; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1016932373 C -> T LOC_Os10g32250.1 downstream_gene_variant ; 520.0bp to feature; MODIFIER silent_mutation Average:31.885; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1016932373 C -> T LOC_Os10g32260.1 downstream_gene_variant ; 434.0bp to feature; MODIFIER silent_mutation Average:31.885; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1016932373 C -> T LOC_Os10g32250-LOC_Os10g32260 intergenic_region ; MODIFIER silent_mutation Average:31.885; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016932373 NA 1.52E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016932373 NA 1.44E-10 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016932373 NA 2.81E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016932373 NA 3.25E-06 mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016932373 NA 9.05E-06 mr1571 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016932373 NA 1.97E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016932373 NA 1.08E-07 mr1498_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016932373 NA 1.30E-08 mr1925_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251