Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016920322:

Variant ID: vg1016920322 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16920322
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATCGAGGAGACCGCTCAAACGAGGACCGAGACCATGATAACCGCCACAACCACCACGATCACAACGACCGTGAACGACGGGTGCCAGACGATACTGGT[C/T]
GAGGACGTCGCCATAACGACGACGATGATGGAGACCAGCGCCGAGACAACAGCGGGAGACGATGACAGGATTCTCGAGATCCAGGCCGACATCCTCGTAA

Reverse complement sequence

TTACGAGGATGTCGGCCTGGATCTCGAGAATCCTGTCATCGTCTCCCGCTGTTGTCTCGGCGCTGGTCTCCATCATCGTCGTCGTTATGGCGACGTCCTC[G/A]
ACCAGTATCGTCTGGCACCCGTCGTTCACGGTCGTTGTGATCGTGGTGGTTGTGGCGGTTATCATGGTCTCGGTCCTCGTTTGAGCGGTCTCCTCGATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.40%	10.20%	0.36%	0.02%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	68.20%	30.70%	1.06%	0.07%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.80%	0.00%	0.00%	NA
Temperate Japonica	767	97.40%	2.20%	0.39%	0.00%	NA
Tropical Japonica	504	19.40%	79.00%	1.59%	0.00%	NA
Japonica Intermediate	241	77.20%	20.30%	2.07%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	7.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016920322	C -> T	LOC_Os10g32210.1	downstream_gene_variant ; 384.0bp to feature; MODIFIER	silent_mutation	Average:57.59; most accessible tissue: Zhenshan97 flag leaf, score: 74.825	N	N	N	N
vg1016920322	C -> T	LOC_Os10g32210-LOC_Os10g32240	intergenic_region ; MODIFIER	silent_mutation	Average:57.59; most accessible tissue: Zhenshan97 flag leaf, score: 74.825	N	N	N	N
vg1016920322	C -> DEL	N	N	silent_mutation	Average:57.59; most accessible tissue: Zhenshan97 flag leaf, score: 74.825	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016920322	NA	2.21E-06	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322	NA	2.67E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322	NA	1.58E-08	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322	NA	3.08E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322	NA	2.82E-28	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322	8.56E-08	3.15E-19	mr1871	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322	NA	5.06E-07	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322	NA	6.20E-19	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322	NA	2.73E-09	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322	NA	2.35E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322	NA	1.13E-11	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322	NA	5.49E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322	NA	8.98E-22	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322	NA	1.66E-08	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251