\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016920322:

Variant ID: vg1016920322 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16920322
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATCGAGGAGACCGCTCAAACGAGGACCGAGACCATGATAACCGCCACAACCACCACGATCACAACGACCGTGAACGACGGGTGCCAGACGATACTGGT[C/T]
GAGGACGTCGCCATAACGACGACGATGATGGAGACCAGCGCCGAGACAACAGCGGGAGACGATGACAGGATTCTCGAGATCCAGGCCGACATCCTCGTAA

Reverse complement sequence

TTACGAGGATGTCGGCCTGGATCTCGAGAATCCTGTCATCGTCTCCCGCTGTTGTCTCGGCGCTGGTCTCCATCATCGTCGTCGTTATGGCGACGTCCTC[G/A]
ACCAGTATCGTCTGGCACCCGTCGTTCACGGTCGTTGTGATCGTGGTGGTTGTGGCGGTTATCATGGTCTCGGTCCTCGTTTGAGCGGTCTCCTCGATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.40% 10.20% 0.36% 0.02% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 68.20% 30.70% 1.06% 0.07% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 97.40% 2.20% 0.39% 0.00% NA
Tropical Japonica  504 19.40% 79.00% 1.59% 0.00% NA
Japonica Intermediate  241 77.20% 20.30% 2.07% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016920322 C -> T LOC_Os10g32210.1 downstream_gene_variant ; 384.0bp to feature; MODIFIER silent_mutation Average:57.59; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg1016920322 C -> T LOC_Os10g32210-LOC_Os10g32240 intergenic_region ; MODIFIER silent_mutation Average:57.59; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg1016920322 C -> DEL N N silent_mutation Average:57.59; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016920322 NA 2.21E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322 NA 2.67E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322 NA 1.58E-08 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322 NA 3.08E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322 NA 2.82E-28 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322 8.56E-08 3.15E-19 mr1871 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322 NA 5.06E-07 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322 NA 6.20E-19 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322 NA 2.73E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322 NA 2.35E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322 NA 1.13E-11 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322 NA 5.49E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322 NA 8.98E-22 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016920322 NA 1.66E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251