Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016918669:

Variant ID: vg1016918669 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 16918669
Reference Allele: GTA	Alternative Allele: ATA,G
Primary Allele: GTA	Secondary Allele: ATA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGCGCATACATATACTTCCCGCGTACACTAAGAAAATCCTTCACGAAGTCTACGGAGGGGAAGAGTTTTACTCGGACAAGACTGGGTCATCAATATATC[GTA/ATA,G]
TAGGGTTTGTTATCTCCGAGTTCTACTTGGAAATCGTCTGACCTACGATATAAAAGGGACCACCGGGGAGGACCTGGAGCATCGAATCTCAGAGCCAACA

Reverse complement sequence

TGTTGGCTCTGAGATTCGATGCTCCAGGTCCTCCCCGGTGGTCCCTTTTATATCGTAGGTCAGACGATTTCCAAGTAGAACTCGGAGATAACAAACCCTA[TAC/TAT,C]
GATATATTGATGACCCAGTCTTGTCCGAGTAAAACTCTTCCCCTCCGTAGACTTCGTGAAGGATTTTCTTAGTGTACGCGGGAAGTATATGTATGCGCGT

Allele Frequencies:

Populations	Population Size	Frequency of GTA(primary allele)	Frequency of ATA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.20%	46.40%	0.08%	0.25%	G: 0.02%
All Indica	2759	26.60%	72.80%	0.11%	0.43%	G: 0.04%
All Japonica	1512	92.90%	7.10%	0.07%	0.00%	NA
Aus	269	85.10%	14.90%	0.00%	0.00%	NA
Indica I	595	32.60%	67.20%	0.00%	0.17%	NA
Indica II	465	19.40%	80.20%	0.22%	0.22%	NA
Indica III	913	25.20%	74.30%	0.11%	0.44%	NA
Indica Intermediate	786	28.10%	70.90%	0.13%	0.76%	G: 0.13%
Temperate Japonica	767	98.30%	1.70%	0.00%	0.00%	NA
Tropical Japonica	504	95.00%	5.00%	0.00%	0.00%	NA
Japonica Intermediate	241	71.00%	28.60%	0.41%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	60.00%	40.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016918669	GTA -> ATA	LOC_Os10g32210.1	upstream_gene_variant ; 556.0bp to feature; MODIFIER	silent_mutation	Average:50.737; most accessible tissue: Zhenshan97 flower, score: 79.85	N	N	N	N
vg1016918669	GTA -> ATA	LOC_Os10g32199-LOC_Os10g32210	intergenic_region ; MODIFIER	silent_mutation	Average:50.737; most accessible tissue: Zhenshan97 flower, score: 79.85	N	N	N	N
vg1016918669	GTA -> G	LOC_Os10g32210.1	upstream_gene_variant ; 555.0bp to feature; MODIFIER	silent_mutation	Average:50.737; most accessible tissue: Zhenshan97 flower, score: 79.85	N	N	N	N
vg1016918669	GTA -> G	LOC_Os10g32199-LOC_Os10g32210	intergenic_region ; MODIFIER	silent_mutation	Average:50.737; most accessible tissue: Zhenshan97 flower, score: 79.85	N	N	N	N
vg1016918669	GTA -> DEL	N	N	silent_mutation	Average:50.737; most accessible tissue: Zhenshan97 flower, score: 79.85	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016918669	NA	1.18E-08	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016918669	NA	4.83E-06	mr1207	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016918669	NA	1.98E-14	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016918669	NA	2.58E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016918669	NA	5.56E-10	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016918669	NA	3.52E-13	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016918669	NA	5.53E-06	mr1316	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016918669	NA	2.17E-07	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016918669	NA	3.79E-09	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016918669	4.91E-06	4.91E-06	mr1463	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016918669	7.84E-06	8.75E-07	mr1511	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016918669	NA	2.08E-06	mr1656	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016918669	NA	9.17E-10	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016918669	NA	3.23E-06	mr1716	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016918669	NA	7.48E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016918669	NA	6.07E-07	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016918669	NA	3.80E-06	mr1872	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016918669	NA	6.99E-06	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016918669	NA	1.37E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016918669	NA	7.17E-08	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016918669	NA	5.61E-07	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251