\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016899401:

Variant ID: vg1016899401 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16899401
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.65, C: 0.35, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGTATTGCTACACACAATTAGGGGCATATATATGAGTGTGTGCCTTCGATCTGATCTGCCTTGGGATCAATACACTATGTAATTAGTCAAACATGTTG[A/C]
TCTGTCCAGCGATCAGTTCCTATAAAATTGTGCCGATTAGTGCCTAATTAACTCAAAGCTTTGAAAAAGCTCGCCCTACAAAGGCAACCTATATCAACAC

Reverse complement sequence

GTGTTGATATAGGTTGCCTTTGTAGGGCGAGCTTTTTCAAAGCTTTGAGTTAATTAGGCACTAATCGGCACAATTTTATAGGAACTGATCGCTGGACAGA[T/G]
CAACATGTTTGACTAATTACATAGTGTATTGATCCCAAGGCAGATCAGATCGAAGGCACACACTCATATATATGCCCCTAATTGTGTGTAGCAATACAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.40% 24.60% 0.00% 0.00% NA
All Indica  2759 98.80% 1.20% 0.00% 0.00% NA
All Japonica  1512 29.20% 70.80% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 2.00% 0.00% 0.00% NA
Temperate Japonica  767 5.70% 94.30% 0.00% 0.00% NA
Tropical Japonica  504 55.20% 44.80% 0.00% 0.00% NA
Japonica Intermediate  241 49.80% 50.20% 0.00% 0.00% NA
VI/Aromatic  96 71.90% 28.10% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016899401 A -> C LOC_Os10g32170.1 upstream_gene_variant ; 600.0bp to feature; MODIFIER silent_mutation Average:66.471; most accessible tissue: Callus, score: 94.626 N N N N
vg1016899401 A -> C LOC_Os10g32160.1 downstream_gene_variant ; 4596.0bp to feature; MODIFIER silent_mutation Average:66.471; most accessible tissue: Callus, score: 94.626 N N N N
vg1016899401 A -> C LOC_Os10g32190.1 downstream_gene_variant ; 1914.0bp to feature; MODIFIER silent_mutation Average:66.471; most accessible tissue: Callus, score: 94.626 N N N N
vg1016899401 A -> C LOC_Os10g32170-LOC_Os10g32190 intergenic_region ; MODIFIER silent_mutation Average:66.471; most accessible tissue: Callus, score: 94.626 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016899401 NA 4.86E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 7.73E-06 mr1084 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 1.05E-17 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 3.83E-08 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 5.86E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 3.34E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 6.25E-06 mr1171 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 2.23E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 2.50E-07 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 2.00E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 7.43E-06 NA mr1288 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 7.88E-06 NA mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 1.41E-39 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 3.18E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 3.36E-24 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 1.00E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 5.52E-27 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 3.60E-06 NA mr1641 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 6.99E-06 mr1641 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 2.15E-08 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 5.05E-22 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 8.27E-09 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 2.55E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 6.39E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 9.85E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 6.70E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899401 NA 2.44E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251