\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016899005:

Variant ID: vg1016899005 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16899005
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 128. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGGATTCACGTGCATGCGGGTTGAGAAATGAGAAATCCAAAGTCAGCTTTGCTTAAGCAACGTCAAAAAGGGAATCGGGGTTGGTTAATTAATTAGGG[T/C]
TCAGGAGGAAATTAGAGGAGACATGAAATTAATGAAGTGCGTGGCGGTGCGCATCAGAGCATTGAGATACTGAGATCGATCGACCAGGAGAATCCGATTA

Reverse complement sequence

TAATCGGATTCTCCTGGTCGATCGATCTCAGTATCTCAATGCTCTGATGCGCACCGCCACGCACTTCATTAATTTCATGTCTCCTCTAATTTCCTCCTGA[A/G]
CCCTAATTAATTAACCAACCCCGATTCCCTTTTTGACGTTGCTTAAGCAAAGCTGACTTTGGATTTCTCATTTCTCAACCCGCATGCACGTGAATCCCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.40% 38.50% 0.06% 0.02% NA
All Indica  2759 87.10% 12.80% 0.07% 0.04% NA
All Japonica  1512 27.40% 72.60% 0.00% 0.00% NA
Aus  269 15.20% 84.80% 0.00% 0.00% NA
Indica I  595 82.40% 17.50% 0.00% 0.17% NA
Indica II  465 88.60% 11.40% 0.00% 0.00% NA
Indica III  913 89.90% 10.10% 0.00% 0.00% NA
Indica Intermediate  786 86.50% 13.20% 0.25% 0.00% NA
Temperate Japonica  767 4.30% 95.70% 0.00% 0.00% NA
Tropical Japonica  504 52.60% 47.40% 0.00% 0.00% NA
Japonica Intermediate  241 48.10% 51.90% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 47.80% 51.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016899005 T -> C LOC_Os10g32170.1 upstream_gene_variant ; 204.0bp to feature; MODIFIER silent_mutation Average:74.143; most accessible tissue: Callus, score: 98.642 N N N N
vg1016899005 T -> C LOC_Os10g32160.1 downstream_gene_variant ; 4200.0bp to feature; MODIFIER silent_mutation Average:74.143; most accessible tissue: Callus, score: 98.642 N N N N
vg1016899005 T -> C LOC_Os10g32190.1 downstream_gene_variant ; 2310.0bp to feature; MODIFIER silent_mutation Average:74.143; most accessible tissue: Callus, score: 98.642 N N N N
vg1016899005 T -> C LOC_Os10g32170-LOC_Os10g32190 intergenic_region ; MODIFIER silent_mutation Average:74.143; most accessible tissue: Callus, score: 98.642 N N N N
vg1016899005 T -> DEL N N silent_mutation Average:74.143; most accessible tissue: Callus, score: 98.642 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1016899005 T C 0.09 -0.01 -0.01 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016899005 NA 5.65E-06 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 9.17E-10 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 4.24E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 5.02E-09 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 2.73E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 8.57E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 5.56E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 1.80E-06 mr1084 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 9.26E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 1.92E-09 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 4.66E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 1.93E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 3.75E-19 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 1.06E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 1.58E-07 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 3.73E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 3.76E-10 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 2.17E-06 mr1263 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 3.98E-15 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 5.46E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 2.04E-06 7.40E-06 mr1288 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 3.32E-11 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 3.96E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 9.65E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 1.27E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 7.68E-06 mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 7.81E-14 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 2.58E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 4.62E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 9.20E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 6.55E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 2.17E-06 mr1451 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 5.95E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 3.82E-06 mr1528 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 3.54E-13 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 1.39E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 3.07E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 5.09E-07 mr1641 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 6.18E-06 mr1656 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 1.11E-09 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 3.60E-11 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 1.93E-06 mr1716 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 2.84E-13 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 1.26E-08 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 7.09E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 1.10E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 4.05E-06 mr1775 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 1.97E-06 mr1783 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 3.11E-08 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 NA 4.99E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016899005 1.76E-06 NA mr1947 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251