\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016882893:

Variant ID: vg1016882893 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16882893
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 38. )

Flanking Sequence (100 bp) in Reference Genome:


TCGGAAACTCGCCGGTTTCCTACTCCCCGTTGAGGCGAGCCCAACTCCACCGCTCAACCACGAAGCCACCGCACACCCCCTTCGTCAAGGGGTGGGCAAG[A/G]
CGGGAGCCGGCCCACAGAGAGGACTACCCAAGCCTCGATCACTCGGGGTAGTTCTTCCTTCACTCCGAAGGTGGTGAACTCCAAACCACTCACAAACCGG

Reverse complement sequence

CCGGTTTGTGAGTGGTTTGGAGTTCACCACCTTCGGAGTGAAGGAAGAACTACCCCGAGTGATCGAGGCTTGGGTAGTCCTCTCTGTGGGCCGGCTCCCG[T/C]
CTTGCCCACCCCTTGACGAAGGGGGTGTGCGGTGGCTTCGTGGTTGAGCGGTGGAGTTGGGCTCGCCTCAACGGGGAGTAGGAAACCGGCGAGTTTCCGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.50% 9.60% 15.57% 50.30% NA
All Indica  2759 1.90% 16.10% 15.66% 66.29% NA
All Japonica  1512 71.00% 0.30% 2.05% 26.59% NA
Aus  269 1.10% 0.00% 72.12% 26.77% NA
Indica I  595 1.30% 28.90% 7.90% 61.85% NA
Indica II  465 4.10% 13.10% 11.83% 70.97% NA
Indica III  913 1.00% 10.40% 21.91% 66.70% NA
Indica Intermediate  786 2.20% 14.90% 16.54% 66.41% NA
Temperate Japonica  767 94.50% 0.30% 0.00% 5.22% NA
Tropical Japonica  504 45.40% 0.60% 5.16% 48.81% NA
Japonica Intermediate  241 49.80% 0.00% 2.07% 48.13% NA
VI/Aromatic  96 1.00% 0.00% 63.54% 35.42% NA
Intermediate  90 32.20% 3.30% 20.00% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016882893 A -> G LOC_Os10g32124.1 upstream_gene_variant ; 465.0bp to feature; MODIFIER silent_mutation Average:5.621; most accessible tissue: Callus, score: 8.57 N N N N
vg1016882893 A -> G LOC_Os10g32140.1 upstream_gene_variant ; 3210.0bp to feature; MODIFIER silent_mutation Average:5.621; most accessible tissue: Callus, score: 8.57 N N N N
vg1016882893 A -> G LOC_Os10g32150.1 downstream_gene_variant ; 4779.0bp to feature; MODIFIER silent_mutation Average:5.621; most accessible tissue: Callus, score: 8.57 N N N N
vg1016882893 A -> G LOC_Os10g32124-LOC_Os10g32140 intergenic_region ; MODIFIER silent_mutation Average:5.621; most accessible tissue: Callus, score: 8.57 N N N N
vg1016882893 A -> DEL N N silent_mutation Average:5.621; most accessible tissue: Callus, score: 8.57 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016882893 NA 2.67E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 3.15E-09 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 8.77E-08 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 2.96E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 7.83E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 7.54E-06 mr1084 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 5.53E-16 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 2.45E-09 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 6.43E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 2.89E-12 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 8.92E-19 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 9.67E-08 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 1.47E-07 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 8.15E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 2.05E-09 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 1.38E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 8.19E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 3.67E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 6.09E-06 mr1528 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 1.45E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 5.12E-06 NA mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 1.91E-06 mr1641 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 5.78E-06 mr1656 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 1.17E-08 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 4.34E-11 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 1.13E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 1.08E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 4.25E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 4.70E-06 mr1775 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 NA 4.03E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016882893 3.41E-06 NA mr1948 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251