\
| Variant ID: vg1016877035 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 16877035 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTAGCAAAGTGAGGCTTGGAAAACATATAGGGACCCTTTTGAAACATTTTCCAAGAGATAGTTTTCAAATTTCATTGATTTTGCAAAAGTTTTGACTTAT[A/G]
TTGACTTGGGCATTTTGAAAACACTACTAGCACTTTTAGTTGATTTGCTCACATATAAAAGGAAGTAGAGCACATGCAAGAGTCCAAAACTGCCCCTTAA
TTAAGGGGCAGTTTTGGACTCTTGCATGTGCTCTACTTCCTTTTATATGTGAGCAAATCAACTAAAAGTGCTAGTAGTGTTTTCAAAATGCCCAAGTCAA[T/C]
ATAAGTCAAAACTTTTGCAAAATCAATGAAATTTGAAAACTATCTCTTGGAAAATGTTTCAAAAGGGTCCCTATATGTTTTCCAAGCCTCACTTTGCTAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.50% | 0.20% | 22.62% | 48.67% | NA |
| All Indica | 2759 | 5.10% | 0.20% | 28.16% | 66.47% | NA |
| All Japonica | 1512 | 75.30% | 0.00% | 4.43% | 20.30% | NA |
| Aus | 269 | 5.60% | 0.00% | 63.20% | 31.23% | NA |
| Indica I | 595 | 3.90% | 0.20% | 26.05% | 69.92% | NA |
| Indica II | 465 | 5.80% | 0.40% | 24.95% | 68.82% | NA |
| Indica III | 913 | 3.90% | 0.10% | 30.12% | 65.83% | NA |
| Indica Intermediate | 786 | 7.10% | 0.30% | 29.39% | 63.23% | NA |
| Temperate Japonica | 767 | 96.30% | 0.00% | 1.17% | 2.48% | NA |
| Tropical Japonica | 504 | 51.40% | 0.00% | 7.74% | 40.87% | NA |
| Japonica Intermediate | 241 | 58.10% | 0.00% | 7.88% | 34.02% | NA |
| VI/Aromatic | 96 | 19.80% | 0.00% | 32.29% | 47.92% | NA |
| Intermediate | 90 | 37.80% | 3.30% | 26.67% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1016877035 | A -> G | LOC_Os10g32124.1 | intron_variant ; MODIFIER | silent_mutation | Average:6.193; most accessible tissue: Callus, score: 15.342 | N | N | N | N |
| vg1016877035 | A -> DEL | N | N | silent_mutation | Average:6.193; most accessible tissue: Callus, score: 15.342 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1016877035 | NA | 1.28E-07 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 1.32E-06 | mr1049 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 2.91E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | 4.08E-09 | NA | mr1084 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 2.79E-06 | mr1084 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 1.09E-18 | mr1156 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 1.74E-07 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 2.43E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 7.31E-19 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 3.18E-07 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 4.89E-06 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 3.42E-08 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 5.99E-07 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | 1.35E-06 | NA | mr1288 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | 5.73E-06 | 3.11E-10 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 2.19E-23 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 5.37E-06 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 9.55E-26 | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 2.07E-08 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 1.22E-08 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 2.38E-06 | mr1656 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 1.77E-07 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 2.45E-06 | mr1704 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | 4.69E-06 | 9.71E-07 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 4.98E-15 | mr1740 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 2.16E-09 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 7.36E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 3.55E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | 7.04E-06 | NA | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 7.94E-06 | mr1775 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 1.97E-06 | mr1783 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 6.46E-08 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 2.99E-08 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 3.93E-06 | mr1826 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 3.75E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | 4.82E-06 | 8.63E-06 | mr1852 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016877035 | NA | 4.36E-09 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |