Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016851622:

Variant ID: vg1016851622 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 16851622
Reference Allele: T	Alternative Allele: C,TC
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAGCTTTTTTTTTTTAGGTAGATTTCACCGTGTGATATGTTCACTACATTGATTGATACTCCCTCCGTTTCGAAATGTTTGGCACCGTTGACTTTTTAG[T/C,TC]
ATATATTTAACCGTTCGTCTTATTCAAAAACTTTTGTGAAATATGTAAAATTATACGCCTACATCAAAATATATTTAACAATGAATCAAATGATAGGAAA

Reverse complement sequence

TTTCCTATCATTTGATTCATTGTTAAATATATTTTGATGTAGGCGTATAATTTTACATATTTCACAAAAGTTTTTGAATAAGACGAACGGTTAAATATAT[A/G,GA]
CTAAAAAGTCAACGGTGCCAAACATTTCGAAACGGAGGGAGTATCAATCAATGTAGTGAACATATCACACGGTGAAATCTACCTAAAAAAAAAAAGCTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.30%	30.80%	8.02%	10.58%	TC: 0.28%
All Indica	2759	70.90%	1.60%	11.89%	15.15%	TC: 0.47%
All Japonica	1512	5.70%	90.70%	1.72%	1.85%	NA
Aus	269	88.10%	0.40%	7.06%	4.46%	NA
Indica I	595	59.00%	0.50%	22.52%	17.14%	TC: 0.84%
Indica II	465	67.30%	3.90%	12.90%	15.48%	TC: 0.43%
Indica III	913	78.40%	0.40%	5.59%	15.55%	NA
Indica Intermediate	786	73.30%	2.40%	10.56%	12.98%	TC: 0.76%
Temperate Japonica	767	1.60%	96.60%	1.30%	0.52%	NA
Tropical Japonica	504	4.60%	92.50%	0.99%	1.98%	NA
Japonica Intermediate	241	21.20%	68.50%	4.56%	5.81%	NA
VI/Aromatic	96	63.50%	1.00%	2.08%	33.33%	NA
Intermediate	90	43.30%	41.10%	4.44%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016851622	T -> DEL	N	N	silent_mutation	Average:63.792; most accessible tissue: Zhenshan97 flower, score: 83.061	N	N	N	N
vg1016851622	T -> C	LOC_Os10g32070.1	upstream_gene_variant ; 2471.0bp to feature; MODIFIER	silent_mutation	Average:63.792; most accessible tissue: Zhenshan97 flower, score: 83.061	N	N	N	N
vg1016851622	T -> C	LOC_Os10g32090.1	upstream_gene_variant ; 2499.0bp to feature; MODIFIER	silent_mutation	Average:63.792; most accessible tissue: Zhenshan97 flower, score: 83.061	N	N	N	N
vg1016851622	T -> C	LOC_Os10g32080.1	downstream_gene_variant ; 290.0bp to feature; MODIFIER	silent_mutation	Average:63.792; most accessible tissue: Zhenshan97 flower, score: 83.061	N	N	N	N
vg1016851622	T -> C	LOC_Os10g32070-LOC_Os10g32080	intergenic_region ; MODIFIER	silent_mutation	Average:63.792; most accessible tissue: Zhenshan97 flower, score: 83.061	N	N	N	N
vg1016851622	T -> TC	LOC_Os10g32070.1	upstream_gene_variant ; 2472.0bp to feature; MODIFIER	silent_mutation	Average:63.792; most accessible tissue: Zhenshan97 flower, score: 83.061	N	N	N	N
vg1016851622	T -> TC	LOC_Os10g32090.1	upstream_gene_variant ; 2498.0bp to feature; MODIFIER	silent_mutation	Average:63.792; most accessible tissue: Zhenshan97 flower, score: 83.061	N	N	N	N
vg1016851622	T -> TC	LOC_Os10g32080.1	downstream_gene_variant ; 289.0bp to feature; MODIFIER	silent_mutation	Average:63.792; most accessible tissue: Zhenshan97 flower, score: 83.061	N	N	N	N
vg1016851622	T -> TC	LOC_Os10g32070-LOC_Os10g32080	intergenic_region ; MODIFIER	silent_mutation	Average:63.792; most accessible tissue: Zhenshan97 flower, score: 83.061	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016851622	NA	1.24E-16	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622	NA	6.76E-06	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622	NA	7.75E-13	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622	NA	4.46E-12	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622	NA	6.36E-10	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622	NA	8.83E-16	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622	NA	4.68E-20	mr1518	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622	NA	7.17E-35	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622	NA	6.19E-24	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622	NA	8.98E-20	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622	NA	8.50E-15	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622	NA	2.80E-28	mr1631	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622	NA	7.46E-10	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622	NA	3.92E-20	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622	NA	3.78E-06	mr1716	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622	NA	2.65E-07	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622	NA	1.42E-23	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622	NA	3.67E-10	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622	NA	2.81E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622	NA	6.28E-06	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622	NA	1.05E-18	mr1383_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251