\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016851622:

Variant ID: vg1016851622 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 16851622
Reference Allele: TAlternative Allele: C,TC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAGCTTTTTTTTTTTAGGTAGATTTCACCGTGTGATATGTTCACTACATTGATTGATACTCCCTCCGTTTCGAAATGTTTGGCACCGTTGACTTTTTAG[T/C,TC]
ATATATTTAACCGTTCGTCTTATTCAAAAACTTTTGTGAAATATGTAAAATTATACGCCTACATCAAAATATATTTAACAATGAATCAAATGATAGGAAA

Reverse complement sequence

TTTCCTATCATTTGATTCATTGTTAAATATATTTTGATGTAGGCGTATAATTTTACATATTTCACAAAAGTTTTTGAATAAGACGAACGGTTAAATATAT[A/G,GA]
CTAAAAAGTCAACGGTGCCAAACATTTCGAAACGGAGGGAGTATCAATCAATGTAGTGAACATATCACACGGTGAAATCTACCTAAAAAAAAAAAGCTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.30% 30.80% 8.02% 10.58% TC: 0.28%
All Indica  2759 70.90% 1.60% 11.89% 15.15% TC: 0.47%
All Japonica  1512 5.70% 90.70% 1.72% 1.85% NA
Aus  269 88.10% 0.40% 7.06% 4.46% NA
Indica I  595 59.00% 0.50% 22.52% 17.14% TC: 0.84%
Indica II  465 67.30% 3.90% 12.90% 15.48% TC: 0.43%
Indica III  913 78.40% 0.40% 5.59% 15.55% NA
Indica Intermediate  786 73.30% 2.40% 10.56% 12.98% TC: 0.76%
Temperate Japonica  767 1.60% 96.60% 1.30% 0.52% NA
Tropical Japonica  504 4.60% 92.50% 0.99% 1.98% NA
Japonica Intermediate  241 21.20% 68.50% 4.56% 5.81% NA
VI/Aromatic  96 63.50% 1.00% 2.08% 33.33% NA
Intermediate  90 43.30% 41.10% 4.44% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016851622 T -> DEL N N silent_mutation Average:63.792; most accessible tissue: Zhenshan97 flower, score: 83.061 N N N N
vg1016851622 T -> C LOC_Os10g32070.1 upstream_gene_variant ; 2471.0bp to feature; MODIFIER silent_mutation Average:63.792; most accessible tissue: Zhenshan97 flower, score: 83.061 N N N N
vg1016851622 T -> C LOC_Os10g32090.1 upstream_gene_variant ; 2499.0bp to feature; MODIFIER silent_mutation Average:63.792; most accessible tissue: Zhenshan97 flower, score: 83.061 N N N N
vg1016851622 T -> C LOC_Os10g32080.1 downstream_gene_variant ; 290.0bp to feature; MODIFIER silent_mutation Average:63.792; most accessible tissue: Zhenshan97 flower, score: 83.061 N N N N
vg1016851622 T -> C LOC_Os10g32070-LOC_Os10g32080 intergenic_region ; MODIFIER silent_mutation Average:63.792; most accessible tissue: Zhenshan97 flower, score: 83.061 N N N N
vg1016851622 T -> TC LOC_Os10g32070.1 upstream_gene_variant ; 2472.0bp to feature; MODIFIER silent_mutation Average:63.792; most accessible tissue: Zhenshan97 flower, score: 83.061 N N N N
vg1016851622 T -> TC LOC_Os10g32090.1 upstream_gene_variant ; 2498.0bp to feature; MODIFIER silent_mutation Average:63.792; most accessible tissue: Zhenshan97 flower, score: 83.061 N N N N
vg1016851622 T -> TC LOC_Os10g32080.1 downstream_gene_variant ; 289.0bp to feature; MODIFIER silent_mutation Average:63.792; most accessible tissue: Zhenshan97 flower, score: 83.061 N N N N
vg1016851622 T -> TC LOC_Os10g32070-LOC_Os10g32080 intergenic_region ; MODIFIER silent_mutation Average:63.792; most accessible tissue: Zhenshan97 flower, score: 83.061 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016851622 NA 1.24E-16 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622 NA 6.76E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622 NA 7.75E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622 NA 4.46E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622 NA 6.36E-10 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622 NA 8.83E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622 NA 4.68E-20 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622 NA 7.17E-35 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622 NA 6.19E-24 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622 NA 8.98E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622 NA 8.50E-15 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622 NA 2.80E-28 mr1631 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622 NA 7.46E-10 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622 NA 3.92E-20 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622 NA 3.78E-06 mr1716 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622 NA 2.65E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622 NA 1.42E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622 NA 3.67E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622 NA 2.81E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622 NA 6.28E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016851622 NA 1.05E-18 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251