Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016837158:

Variant ID: vg1016837158 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16837158
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAGAGTTTAAACAGAAATTAATGTTAAGGTCGACACAAATTTCAGCAAAATTTGGATAACAAGAGGGTGGTTGGGCCGGGGCCCGAGGGAGTTGTACT[C/T]
TATAAATGCTTATATTTGTGGATAAATTTTAAATGTTAGAAATAGTTATATTCATGAACAAGAAATGCAGTGAGATAACATGGATTCCTCTCCCGACTGT

Reverse complement sequence

ACAGTCGGGAGAGGAATCCATGTTATCTCACTGCATTTCTTGTTCATGAATATAACTATTTCTAACATTTAAAATTTATCCACAAATATAAGCATTTATA[G/A]
AGTACAACTCCCTCGGGCCCCGGCCCAACCACCCTCTTGTTATCCAAATTTTGCTGAAATTTGTGTCGACCTTAACATTAATTTCTGTTTAAACTCTTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.40%	6.60%	0.00%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	80.00%	20.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	97.70%	2.30%	0.00%	0.00%	NA
Tropical Japonica	504	52.60%	47.40%	0.00%	0.00%	NA
Japonica Intermediate	241	80.90%	19.10%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016837158	C -> T	LOC_Os10g32040.1	upstream_gene_variant ; 1473.0bp to feature; MODIFIER	silent_mutation	Average:50.907; most accessible tissue: Zhenshan97 flower, score: 67.623	N	N	N	N
vg1016837158	C -> T	LOC_Os10g32050.1	upstream_gene_variant ; 276.0bp to feature; MODIFIER	silent_mutation	Average:50.907; most accessible tissue: Zhenshan97 flower, score: 67.623	N	N	N	N
vg1016837158	C -> T	LOC_Os10g32060.1	upstream_gene_variant ; 2837.0bp to feature; MODIFIER	silent_mutation	Average:50.907; most accessible tissue: Zhenshan97 flower, score: 67.623	N	N	N	N
vg1016837158	C -> T	LOC_Os10g32050-LOC_Os10g32060	intergenic_region ; MODIFIER	silent_mutation	Average:50.907; most accessible tissue: Zhenshan97 flower, score: 67.623	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016837158	NA	1.80E-10	mr1156	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158	NA	3.24E-06	mr1157	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158	NA	5.59E-08	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158	NA	2.49E-06	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158	NA	2.42E-06	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158	NA	4.74E-07	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158	2.43E-06	1.39E-08	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158	NA	8.52E-09	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158	NA	3.28E-06	mr1378	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158	NA	2.27E-08	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158	NA	5.11E-10	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158	NA	3.84E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158	1.50E-06	2.42E-14	mr1641	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158	NA	1.07E-06	mr1641	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158	NA	5.54E-10	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158	NA	6.14E-07	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158	NA	2.27E-08	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158	NA	4.94E-08	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158	NA	9.80E-06	mr1906	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158	NA	6.56E-06	mr1960	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158	NA	7.09E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251