\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016835838:

Variant ID: vg1016835838 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16835838
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTGTATTTTAATATATGACGCCGTTAACTTTTTTATCAACGTTTAACTATTCGTTTTATTCAAATTTTTTATGCAAATATGAAAATATTTATGTCATG[C/T]
TTAAAGAACATTTGATGATGAATTAAGTCACACTTAAATAAATAATAATTACATAATTTTTTTTAAATAAGATGAATAATCAAACGTTGAACAAAAAGTC

Reverse complement sequence

GACTTTTTGTTCAACGTTTGATTATTCATCTTATTTAAAAAAAATTATGTAATTATTATTTATTTAAGTGTGACTTAATTCATCATCAAATGTTCTTTAA[G/A]
CATGACATAAATATTTTCATATTTGCATAAAAAATTTGAATAAAACGAATAGTTAAACGTTGATAAAAAAGTTAACGGCGTCATATATTAAAATACAGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.70% 7.30% 0.00% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 79.90% 20.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 97.70% 2.30% 0.00% 0.00% NA
Tropical Japonica  504 53.00% 47.00% 0.00% 0.00% NA
Japonica Intermediate  241 79.70% 20.30% 0.00% 0.00% NA
VI/Aromatic  96 71.90% 28.10% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016835838 C -> T LOC_Os10g32030.1 upstream_gene_variant ; 4429.0bp to feature; MODIFIER silent_mutation Average:53.758; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg1016835838 C -> T LOC_Os10g32040.1 upstream_gene_variant ; 153.0bp to feature; MODIFIER silent_mutation Average:53.758; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg1016835838 C -> T LOC_Os10g32060.1 upstream_gene_variant ; 4157.0bp to feature; MODIFIER silent_mutation Average:53.758; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg1016835838 C -> T LOC_Os10g32050.1 downstream_gene_variant ; 11.0bp to feature; MODIFIER silent_mutation Average:53.758; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg1016835838 C -> T LOC_Os10g32040-LOC_Os10g32050 intergenic_region ; MODIFIER silent_mutation Average:53.758; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016835838 NA 1.85E-08 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016835838 NA 3.89E-06 mr1157 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016835838 NA 8.90E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016835838 NA 3.03E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016835838 NA 1.90E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016835838 NA 2.29E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016835838 NA 2.91E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016835838 NA 5.35E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016835838 NA 3.23E-06 mr1641 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016835838 NA 7.80E-09 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016835838 NA 1.96E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016835838 1.24E-06 NA mr1670 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251