\
| Variant ID: vg1016835838 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 16835838 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTCTGTATTTTAATATATGACGCCGTTAACTTTTTTATCAACGTTTAACTATTCGTTTTATTCAAATTTTTTATGCAAATATGAAAATATTTATGTCATG[C/T]
TTAAAGAACATTTGATGATGAATTAAGTCACACTTAAATAAATAATAATTACATAATTTTTTTTAAATAAGATGAATAATCAAACGTTGAACAAAAAGTC
GACTTTTTGTTCAACGTTTGATTATTCATCTTATTTAAAAAAAATTATGTAATTATTATTTATTTAAGTGTGACTTAATTCATCATCAAATGTTCTTTAA[G/A]
CATGACATAAATATTTTCATATTTGCATAAAAAATTTGAATAAAACGAATAGTTAAACGTTGATAAAAAAGTTAACGGCGTCATATATTAAAATACAGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 79.90% | 20.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 53.00% | 47.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.70% | 20.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 71.90% | 28.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1016835838 | C -> T | LOC_Os10g32030.1 | upstream_gene_variant ; 4429.0bp to feature; MODIFIER | silent_mutation | Average:53.758; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg1016835838 | C -> T | LOC_Os10g32040.1 | upstream_gene_variant ; 153.0bp to feature; MODIFIER | silent_mutation | Average:53.758; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg1016835838 | C -> T | LOC_Os10g32060.1 | upstream_gene_variant ; 4157.0bp to feature; MODIFIER | silent_mutation | Average:53.758; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg1016835838 | C -> T | LOC_Os10g32050.1 | downstream_gene_variant ; 11.0bp to feature; MODIFIER | silent_mutation | Average:53.758; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg1016835838 | C -> T | LOC_Os10g32040-LOC_Os10g32050 | intergenic_region ; MODIFIER | silent_mutation | Average:53.758; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1016835838 | NA | 1.85E-08 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016835838 | NA | 3.89E-06 | mr1157 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016835838 | NA | 8.90E-07 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016835838 | NA | 3.03E-06 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016835838 | NA | 1.90E-06 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016835838 | NA | 2.29E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016835838 | NA | 2.91E-08 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016835838 | NA | 5.35E-06 | mr1328 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016835838 | NA | 3.23E-06 | mr1641 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016835838 | NA | 7.80E-09 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016835838 | NA | 1.96E-06 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016835838 | 1.24E-06 | NA | mr1670 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |