\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016820034:

Variant ID: vg1016820034 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16820034
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTGGTGTTCCCCATCCCGGAGACGTCGCACCGGCAAGTGCACCACGTGACGAGCAAGGCGATCAGGCTGGGATCGGGCGGAGACGGCACGGTAGGGTGG[G/A]
TGGACATCTGGCGCGGCATCCTCCTCTGCGACGTGCTCCACGAGAGCCCCAAGCTCCGCGACGTGCCGCTGCCGCCGCCGGCGAAGGGGAACAGCCACAG

Reverse complement sequence

CTGTGGCTGTTCCCCTTCGCCGGCGGCGGCAGCGGCACGTCGCGGAGCTTGGGGCTCTCGTGGAGCACGTCGCAGAGGAGGATGCCGCGCCAGATGTCCA[C/T]
CCACCCTACCGTGCCGTCTCCGCCCGATCCCAGCCTGATCGCCTTGCTCGTCACGTGGTGCACTTGCCGGTGCGACGTCTCCGGGATGGGGAACACCACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.10% 5.80% 0.72% 11.36% NA
All Indica  2759 90.30% 0.10% 1.05% 8.59% NA
All Japonica  1512 81.20% 17.80% 0.07% 0.93% NA
Aus  269 19.30% 0.00% 1.49% 79.18% NA
Indica I  595 85.00% 0.00% 1.18% 13.78% NA
Indica II  465 95.50% 0.00% 1.51% 3.01% NA
Indica III  913 91.10% 0.00% 0.33% 8.54% NA
Indica Intermediate  786 90.20% 0.30% 1.53% 8.02% NA
Temperate Japonica  767 97.50% 2.30% 0.00% 0.13% NA
Tropical Japonica  504 57.10% 40.90% 0.00% 1.98% NA
Japonica Intermediate  241 79.70% 18.70% 0.41% 1.24% NA
VI/Aromatic  96 35.40% 0.00% 0.00% 64.58% NA
Intermediate  90 82.20% 5.60% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016820034 G -> A LOC_Os10g32010.1 missense_variant ; p.Val161Met; MODERATE nonsynonymous_codon ; V161M Average:51.51; most accessible tissue: Minghui63 flower, score: 82.109 probably damaging 2.371 DELETERIOUS 0.00
vg1016820034 G -> DEL LOC_Os10g32010.1 N frameshift_variant Average:51.51; most accessible tissue: Minghui63 flower, score: 82.109 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016820034 NA 4.01E-10 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034 NA 3.27E-06 mr1157 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034 NA 6.50E-09 mr1179 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034 NA 8.63E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034 NA 3.23E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034 NA 5.45E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034 9.96E-06 4.54E-08 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034 NA 4.53E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034 NA 5.45E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034 NA 5.86E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034 NA 2.23E-08 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034 NA 2.57E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034 NA 7.32E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034 NA 7.80E-06 mr1641 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034 NA 8.08E-11 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034 NA 8.60E-08 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034 NA 1.04E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034 NA 6.60E-06 mr1826 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034 NA 3.10E-12 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251