Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1016762508:

Variant ID: vg1016762508 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16762508
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTTACGTGTGTAGAAAAGTTTTTATGCGATGGAAAAGTTGAAAGTTTGTAGATAAAATTGGAAACTTACCTAATTAAGCCTAATTAATTGGGAAATGC[G/T]
AGACGAACTTTTTAAGCCTAATTAATCCATCATTAGCAGATGTTTATTTTAGCACCACATTGTCAAATCATGGAGAAATTAGGCTTAAAAGATTCGTCTC

Reverse complement sequence

GAGACGAATCTTTTAAGCCTAATTTCTCCATGATTTGACAATGTGGTGCTAAAATAAACATCTGCTAATGATGGATTAATTAGGCTTAAAAAGTTCGTCT[C/A]
GCATTTCCCAATTAATTAGGCTTAATTAGGTAAGTTTCCAATTTTATCTACAAACTTTCAACTTTTCCATCGCATAAAAACTTTTCTACACACGTAAACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 40.10% 0.04% 0.00% NA
All Indica  2759 84.30% 15.70% 0.00% 0.00% NA
All Japonica  1512 8.10% 91.90% 0.00% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 82.00% 18.00% 0.00% 0.00% NA
Indica II  465 89.00% 11.00% 0.00% 0.00% NA
Indica III  913 83.90% 16.10% 0.00% 0.00% NA
Indica Intermediate  786 83.70% 16.30% 0.00% 0.00% NA
Temperate Japonica  767 2.20% 97.80% 0.00% 0.00% NA
Tropical Japonica  504 7.30% 92.70% 0.00% 0.00% NA
Japonica Intermediate  241 28.20% 71.80% 0.00% 0.00% NA
VI/Aromatic  96 68.80% 31.20% 0.00% 0.00% NA
Intermediate  90 53.30% 45.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016762508 G -> T LOC_Os10g31910.1 upstream_gene_variant ; 1630.0bp to feature; MODIFIER silent_mutation Average:59.371; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg1016762508 G -> T LOC_Os10g31930.1 upstream_gene_variant ; 4335.0bp to feature; MODIFIER silent_mutation Average:59.371; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg1016762508 G -> T LOC_Os10g31910-LOC_Os10g31930 intergenic_region ; MODIFIER silent_mutation Average:59.371; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016762508 NA 7.72E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 NA 1.23E-06 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 NA 1.26E-07 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 NA 3.53E-10 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 NA 3.23E-06 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 NA 1.30E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 NA 1.06E-06 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 NA 5.02E-06 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 NA 5.11E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 NA 1.26E-08 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 4.01E-06 1.03E-22 mr1689 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 3.73E-06 NA mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 NA 2.21E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 NA 1.32E-08 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 NA 2.42E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 NA 1.22E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 NA 1.23E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 NA 1.15E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 NA 1.66E-13 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 NA 2.76E-06 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 NA 3.93E-06 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016762508 NA 6.05E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251