\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016628078:

Variant ID: vg1016628078 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16628078
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTATTAGCCAGCTATAAACATATTTTAATGAGATAAAAGATAAGAGAGAAAAGCAGCGGGCTACAGATCTGTAGCCAGCTGCAGCACGGACTCCAAGAC[G/A]
CAGTGTTTGTATGACAGGTGGGACCATATATTCATAGTATAATAAGCAACTATTGTATGAATTGGCTATTAGATTGGCTATAGATGAACTAGAGTAAGTA

Reverse complement sequence

TACTTACTCTAGTTCATCTATAGCCAATCTAATAGCCAATTCATACAATAGTTGCTTATTATACTATGAATATATGGTCCCACCTGTCATACAAACACTG[C/T]
GTCTTGGAGTCCGTGCTGCAGCTGGCTACAGATCTGTAGCCCGCTGCTTTTCTCTCTTATCTTTTATCTCATTAAAATATGTTTATAGCTGGCTAATAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.70% 4.00% 4.91% 62.42% NA
All Indica  2759 3.20% 0.10% 5.73% 90.97% NA
All Japonica  1512 78.60% 12.20% 1.79% 7.41% NA
Aus  269 1.90% 0.00% 14.50% 83.64% NA
Indica I  595 3.40% 0.00% 7.90% 88.74% NA
Indica II  465 5.40% 0.20% 2.80% 91.61% NA
Indica III  913 1.30% 0.00% 3.72% 94.96% NA
Indica Intermediate  786 4.10% 0.10% 8.14% 87.66% NA
Temperate Japonica  767 75.90% 19.20% 3.00% 1.96% NA
Tropical Japonica  504 93.70% 0.00% 0.20% 6.15% NA
Japonica Intermediate  241 56.00% 15.40% 1.24% 27.39% NA
VI/Aromatic  96 32.30% 0.00% 6.25% 61.46% NA
Intermediate  90 44.40% 4.40% 2.22% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016628078 G -> A LOC_Os10g31720.1 upstream_gene_variant ; 1505.0bp to feature; MODIFIER silent_mutation Average:16.452; most accessible tissue: Zhenshan97 flower, score: 25.98 N N N N
vg1016628078 G -> A LOC_Os10g31720-LOC_Os10g31730 intergenic_region ; MODIFIER silent_mutation Average:16.452; most accessible tissue: Zhenshan97 flower, score: 25.98 N N N N
vg1016628078 G -> DEL N N silent_mutation Average:16.452; most accessible tissue: Zhenshan97 flower, score: 25.98 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016628078 NA 1.45E-09 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016628078 NA 3.94E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016628078 9.14E-08 9.14E-08 mr1409 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016628078 NA 4.86E-10 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016628078 NA 9.75E-10 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016628078 NA 5.23E-07 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016628078 NA 2.39E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016628078 NA 1.37E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251