\
| Variant ID: vg1016628078 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 16628078 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACTATTAGCCAGCTATAAACATATTTTAATGAGATAAAAGATAAGAGAGAAAAGCAGCGGGCTACAGATCTGTAGCCAGCTGCAGCACGGACTCCAAGAC[G/A]
CAGTGTTTGTATGACAGGTGGGACCATATATTCATAGTATAATAAGCAACTATTGTATGAATTGGCTATTAGATTGGCTATAGATGAACTAGAGTAAGTA
TACTTACTCTAGTTCATCTATAGCCAATCTAATAGCCAATTCATACAATAGTTGCTTATTATACTATGAATATATGGTCCCACCTGTCATACAAACACTG[C/T]
GTCTTGGAGTCCGTGCTGCAGCTGGCTACAGATCTGTAGCCCGCTGCTTTTCTCTCTTATCTTTTATCTCATTAAAATATGTTTATAGCTGGCTAATAGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.70% | 4.00% | 4.91% | 62.42% | NA |
| All Indica | 2759 | 3.20% | 0.10% | 5.73% | 90.97% | NA |
| All Japonica | 1512 | 78.60% | 12.20% | 1.79% | 7.41% | NA |
| Aus | 269 | 1.90% | 0.00% | 14.50% | 83.64% | NA |
| Indica I | 595 | 3.40% | 0.00% | 7.90% | 88.74% | NA |
| Indica II | 465 | 5.40% | 0.20% | 2.80% | 91.61% | NA |
| Indica III | 913 | 1.30% | 0.00% | 3.72% | 94.96% | NA |
| Indica Intermediate | 786 | 4.10% | 0.10% | 8.14% | 87.66% | NA |
| Temperate Japonica | 767 | 75.90% | 19.20% | 3.00% | 1.96% | NA |
| Tropical Japonica | 504 | 93.70% | 0.00% | 0.20% | 6.15% | NA |
| Japonica Intermediate | 241 | 56.00% | 15.40% | 1.24% | 27.39% | NA |
| VI/Aromatic | 96 | 32.30% | 0.00% | 6.25% | 61.46% | NA |
| Intermediate | 90 | 44.40% | 4.40% | 2.22% | 48.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1016628078 | G -> A | LOC_Os10g31720.1 | upstream_gene_variant ; 1505.0bp to feature; MODIFIER | silent_mutation | Average:16.452; most accessible tissue: Zhenshan97 flower, score: 25.98 | N | N | N | N |
| vg1016628078 | G -> A | LOC_Os10g31720-LOC_Os10g31730 | intergenic_region ; MODIFIER | silent_mutation | Average:16.452; most accessible tissue: Zhenshan97 flower, score: 25.98 | N | N | N | N |
| vg1016628078 | G -> DEL | N | N | silent_mutation | Average:16.452; most accessible tissue: Zhenshan97 flower, score: 25.98 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1016628078 | NA | 1.45E-09 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016628078 | NA | 3.94E-07 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016628078 | 9.14E-08 | 9.14E-08 | mr1409 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016628078 | NA | 4.86E-10 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016628078 | NA | 9.75E-10 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016628078 | NA | 5.23E-07 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016628078 | NA | 2.39E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016628078 | NA | 1.37E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |