\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016565386:

Variant ID: vg1016565386 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16565386
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, A: 0.28, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGTCCCTTTTCGATCAATAGATACTCTGAAGGTGTTGATTGCTACATATCACTGTGAGCTACCATTCATGAAGGGCAAAATTTGCTACAGGACACGCA[C/A]
AAATCGTGTAATTAGCTGTAAGACACCAAAAAACGCGTCGCTGCCCACGGACACTACGAAAGTTGTGCAATTGGCTGTAGAACACTGGAGTTAATATTTT

Reverse complement sequence

AAAATATTAACTCCAGTGTTCTACAGCCAATTGCACAACTTTCGTAGTGTCCGTGGGCAGCGACGCGTTTTTTGGTGTCTTACAGCTAATTACACGATTT[G/T]
TGCGTGTCCTGTAGCAAATTTTGCCCTTCATGAATGGTAGCTCACAGTGATATGTAGCAATCAACACCTTCAGAGTATCTATTGATCGAAAAGGGACTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.70% 37.10% 0.11% 0.13% NA
All Indica  2759 90.10% 9.60% 0.11% 0.22% NA
All Japonica  1512 6.40% 93.50% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 74.30% 25.20% 0.00% 0.50% NA
Indica II  465 95.70% 4.30% 0.00% 0.00% NA
Indica III  913 97.60% 2.30% 0.00% 0.11% NA
Indica Intermediate  786 90.10% 9.30% 0.38% 0.25% NA
Temperate Japonica  767 2.00% 97.90% 0.13% 0.00% NA
Tropical Japonica  504 6.30% 93.70% 0.00% 0.00% NA
Japonica Intermediate  241 20.70% 79.30% 0.00% 0.00% NA
VI/Aromatic  96 69.80% 30.20% 0.00% 0.00% NA
Intermediate  90 52.20% 46.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016565386 C -> A LOC_Os10g31600.1 upstream_gene_variant ; 4573.0bp to feature; MODIFIER silent_mutation Average:52.056; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg1016565386 C -> A LOC_Os10g31620.1 downstream_gene_variant ; 1813.0bp to feature; MODIFIER silent_mutation Average:52.056; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg1016565386 C -> A LOC_Os10g31610.1 intron_variant ; MODIFIER silent_mutation Average:52.056; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg1016565386 C -> DEL N N silent_mutation Average:52.056; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016565386 8.29E-06 1.90E-09 mr1071 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 1.42E-06 5.92E-10 mr1080 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 NA 1.48E-07 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 3.02E-06 2.73E-11 mr1140 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 1.79E-06 2.69E-10 mr1203 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 NA 1.64E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 2.22E-06 3.11E-10 mr1395 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 NA 2.12E-09 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 6.48E-07 1.58E-10 mr1618 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 NA 2.72E-08 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 NA 1.74E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 5.99E-06 3.56E-13 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 NA 4.30E-11 mr1071_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 NA 2.45E-10 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 NA 4.74E-08 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 NA 3.64E-11 mr1203_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 NA 3.89E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 NA 2.59E-07 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 NA 4.49E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 NA 1.14E-10 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 NA 2.58E-09 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 NA 1.55E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 8.09E-06 4.70E-11 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386 NA 8.20E-07 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251