Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016562368:

Variant ID: vg1016562368 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16562368
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCGACAATTGGTTTTCTTGGAGAGAGCGGTGTGATAAAATCGAGTTGTTTGTAGTCCGAGTGTTTGATCATTTGCTTGCTTGAGCTAGGATTGAATCTAG[G/A]
CTAGGCCAGCAATTTTGACTAGTACTTTGGACTATTATTCAATTTCGCAAATCTGTTTGATTTTTGCTATTCCTTGTGATATAATTAAGCCTACCAAGAT

Reverse complement sequence

ATCTTGGTAGGCTTAATTATATCACAAGGAATAGCAAAAATCAAACAGATTTGCGAAATTGAATAATAGTCCAAAGTACTAGTCAAAATTGCTGGCCTAG[C/T]
CTAGATTCAATCCTAGCTCAAGCAAGCAAATGATCAAACACTCGGACTACAAACAACTCGATTTTATCACACCGCTCTCTCCAAGAAAACCAATTGTCGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.40%	11.00%	7.36%	21.24%	NA
All Indica	2759	64.90%	0.30%	5.55%	29.29%	NA
All Japonica	1512	62.00%	32.90%	0.93%	4.17%	NA
Aus	269	14.90%	0.40%	59.48%	25.28%	NA
Indica I	595	70.30%	0.00%	9.58%	20.17%	NA
Indica II	465	77.20%	0.90%	2.80%	19.14%	NA
Indica III	913	55.60%	0.10%	3.50%	40.74%	NA
Indica Intermediate	786	64.40%	0.30%	6.49%	28.88%	NA
Temperate Japonica	767	96.60%	2.30%	0.13%	0.91%	NA
Tropical Japonica	504	9.70%	84.50%	1.79%	3.97%	NA
Japonica Intermediate	241	61.00%	22.40%	1.66%	14.94%	NA
VI/Aromatic	96	35.40%	0.00%	14.58%	50.00%	NA
Intermediate	90	58.90%	14.40%	7.78%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016562368	G -> A	LOC_Os10g31600.1	upstream_gene_variant ; 1555.0bp to feature; MODIFIER	silent_mutation	Average:6.453; most accessible tissue: Zhenshan97 flower, score: 13.891	N	N	N	N
vg1016562368	G -> A	LOC_Os10g31610.1	upstream_gene_variant ; 328.0bp to feature; MODIFIER	silent_mutation	Average:6.453; most accessible tissue: Zhenshan97 flower, score: 13.891	N	N	N	N
vg1016562368	G -> A	LOC_Os10g31590.1	downstream_gene_variant ; 4793.0bp to feature; MODIFIER	silent_mutation	Average:6.453; most accessible tissue: Zhenshan97 flower, score: 13.891	N	N	N	N
vg1016562368	G -> A	LOC_Os10g31620.1	downstream_gene_variant ; 4831.0bp to feature; MODIFIER	silent_mutation	Average:6.453; most accessible tissue: Zhenshan97 flower, score: 13.891	N	N	N	N
vg1016562368	G -> A	LOC_Os10g31600-LOC_Os10g31610	intergenic_region ; MODIFIER	silent_mutation	Average:6.453; most accessible tissue: Zhenshan97 flower, score: 13.891	N	N	N	N
vg1016562368	G -> DEL	N	N	silent_mutation	Average:6.453; most accessible tissue: Zhenshan97 flower, score: 13.891	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016562368	NA	4.11E-09	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016562368	NA	7.24E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016562368	NA	2.44E-08	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016562368	NA	2.99E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016562368	NA	3.54E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016562368	NA	2.28E-28	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016562368	NA	3.42E-14	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016562368	NA	2.24E-07	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016562368	NA	4.04E-09	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016562368	NA	1.84E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016562368	3.26E-06	NA	mr1528_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016562368	NA	4.82E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016562368	NA	1.01E-06	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016562368	NA	2.86E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016562368	NA	1.26E-09	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016562368	NA	1.11E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016562368	NA	3.40E-09	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251