\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016561576:

Variant ID: vg1016561576 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16561576
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAAGTGTGTTCATTCGTGAACCTTTTAGAGTGTTAACCACTCGGATTCCTTTTGTTATGGCTAAAAAGCAGTCGGCTAGAATGCCTCTTTAGGCGCCGC[A/G,T]
TATGCTTTTGTCATATGATGCGCGATTGTGCTATTATTTTGTTCTCAACTATATGTTTAGTATGTTAACTAATCACATAGTTGGGGGCTACACCTAATTA

Reverse complement sequence

TAATTAGGTGTAGCCCCCAACTATGTGATTAGTTAACATACTAAACATATAGTTGAGAACAAAATAATAGCACAATCGCGCATCATATGACAAAAGCATA[T/C,A]
GCGGCGCCTAAAGAGGCATTCTAGCCGACTGCTTTTTAGCCATAACAAAAGGAATCCGAGTGGTTAACACTCTAAAAGGTTCACGAATGAACACACTTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.90% 5.60% 31.72% 12.67% T: 0.13%
All Indica  2759 50.60% 1.30% 32.26% 15.80% T: 0.04%
All Japonica  1512 48.30% 13.90% 30.22% 7.54% NA
Aus  269 62.50% 3.00% 30.11% 2.60% T: 1.86%
Indica I  595 39.20% 0.20% 51.09% 9.58% NA
Indica II  465 52.30% 0.90% 30.54% 16.34% NA
Indica III  913 57.40% 2.10% 19.61% 20.92% NA
Indica Intermediate  786 50.30% 1.70% 33.72% 14.25% T: 0.13%
Temperate Japonica  767 80.40% 0.90% 12.91% 5.74% NA
Tropical Japonica  504 7.30% 36.10% 46.43% 10.12% NA
Japonica Intermediate  241 32.00% 8.70% 51.45% 7.88% NA
VI/Aromatic  96 25.00% 2.10% 44.79% 28.12% NA
Intermediate  90 44.40% 7.80% 31.11% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016561576 A -> G LOC_Os10g31600.1 upstream_gene_variant ; 763.0bp to feature; MODIFIER silent_mutation Average:11.376; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1016561576 A -> G LOC_Os10g31610.1 upstream_gene_variant ; 1120.0bp to feature; MODIFIER silent_mutation Average:11.376; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1016561576 A -> G LOC_Os10g31590.1 downstream_gene_variant ; 4001.0bp to feature; MODIFIER silent_mutation Average:11.376; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1016561576 A -> G LOC_Os10g31600-LOC_Os10g31610 intergenic_region ; MODIFIER silent_mutation Average:11.376; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1016561576 A -> T LOC_Os10g31600.1 upstream_gene_variant ; 763.0bp to feature; MODIFIER silent_mutation Average:11.376; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1016561576 A -> T LOC_Os10g31610.1 upstream_gene_variant ; 1120.0bp to feature; MODIFIER silent_mutation Average:11.376; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1016561576 A -> T LOC_Os10g31590.1 downstream_gene_variant ; 4001.0bp to feature; MODIFIER silent_mutation Average:11.376; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1016561576 A -> T LOC_Os10g31600-LOC_Os10g31610 intergenic_region ; MODIFIER silent_mutation Average:11.376; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1016561576 A -> DEL N N silent_mutation Average:11.376; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016561576 NA 3.30E-07 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016561576 5.49E-07 2.19E-09 mr1542 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016561576 NA 8.73E-09 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016561576 NA 3.40E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016561576 NA 2.77E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016561576 NA 6.82E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016561576 NA 9.45E-08 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016561576 NA 2.30E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016561576 NA 5.73E-09 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251