\
| Variant ID: vg1016561576 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 16561576 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCAAGTGTGTTCATTCGTGAACCTTTTAGAGTGTTAACCACTCGGATTCCTTTTGTTATGGCTAAAAAGCAGTCGGCTAGAATGCCTCTTTAGGCGCCGC[A/G,T]
TATGCTTTTGTCATATGATGCGCGATTGTGCTATTATTTTGTTCTCAACTATATGTTTAGTATGTTAACTAATCACATAGTTGGGGGCTACACCTAATTA
TAATTAGGTGTAGCCCCCAACTATGTGATTAGTTAACATACTAAACATATAGTTGAGAACAAAATAATAGCACAATCGCGCATCATATGACAAAAGCATA[T/C,A]
GCGGCGCCTAAAGAGGCATTCTAGCCGACTGCTTTTTAGCCATAACAAAAGGAATCCGAGTGGTTAACACTCTAAAAGGTTCACGAATGAACACACTTGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.90% | 5.60% | 31.72% | 12.67% | T: 0.13% |
| All Indica | 2759 | 50.60% | 1.30% | 32.26% | 15.80% | T: 0.04% |
| All Japonica | 1512 | 48.30% | 13.90% | 30.22% | 7.54% | NA |
| Aus | 269 | 62.50% | 3.00% | 30.11% | 2.60% | T: 1.86% |
| Indica I | 595 | 39.20% | 0.20% | 51.09% | 9.58% | NA |
| Indica II | 465 | 52.30% | 0.90% | 30.54% | 16.34% | NA |
| Indica III | 913 | 57.40% | 2.10% | 19.61% | 20.92% | NA |
| Indica Intermediate | 786 | 50.30% | 1.70% | 33.72% | 14.25% | T: 0.13% |
| Temperate Japonica | 767 | 80.40% | 0.90% | 12.91% | 5.74% | NA |
| Tropical Japonica | 504 | 7.30% | 36.10% | 46.43% | 10.12% | NA |
| Japonica Intermediate | 241 | 32.00% | 8.70% | 51.45% | 7.88% | NA |
| VI/Aromatic | 96 | 25.00% | 2.10% | 44.79% | 28.12% | NA |
| Intermediate | 90 | 44.40% | 7.80% | 31.11% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1016561576 | A -> G | LOC_Os10g31600.1 | upstream_gene_variant ; 763.0bp to feature; MODIFIER | silent_mutation | Average:11.376; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1016561576 | A -> G | LOC_Os10g31610.1 | upstream_gene_variant ; 1120.0bp to feature; MODIFIER | silent_mutation | Average:11.376; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1016561576 | A -> G | LOC_Os10g31590.1 | downstream_gene_variant ; 4001.0bp to feature; MODIFIER | silent_mutation | Average:11.376; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1016561576 | A -> G | LOC_Os10g31600-LOC_Os10g31610 | intergenic_region ; MODIFIER | silent_mutation | Average:11.376; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1016561576 | A -> T | LOC_Os10g31600.1 | upstream_gene_variant ; 763.0bp to feature; MODIFIER | silent_mutation | Average:11.376; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1016561576 | A -> T | LOC_Os10g31610.1 | upstream_gene_variant ; 1120.0bp to feature; MODIFIER | silent_mutation | Average:11.376; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1016561576 | A -> T | LOC_Os10g31590.1 | downstream_gene_variant ; 4001.0bp to feature; MODIFIER | silent_mutation | Average:11.376; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1016561576 | A -> T | LOC_Os10g31600-LOC_Os10g31610 | intergenic_region ; MODIFIER | silent_mutation | Average:11.376; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1016561576 | A -> DEL | N | N | silent_mutation | Average:11.376; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1016561576 | NA | 3.30E-07 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016561576 | 5.49E-07 | 2.19E-09 | mr1542 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016561576 | NA | 8.73E-09 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016561576 | NA | 3.40E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016561576 | NA | 2.77E-07 | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016561576 | NA | 6.82E-10 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016561576 | NA | 9.45E-08 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016561576 | NA | 2.30E-07 | mr1696_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016561576 | NA | 5.73E-09 | mr1879_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |