\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016534305:

Variant ID: vg1016534305 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16534305
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.36, others allele: 0.00, population size: 30. )

Flanking Sequence (100 bp) in Reference Genome:


CTCCCTCCCTTACTCTCTCTCCCTCATCTTCCTTCTCTCCATCATCACTCTCTCCCTCACAGATCAGGCTGTGGCCCCCCTCCCAAGCGCCGGCCGCTGA[C/T]
GCCTCCCCGCCTCCCGATCGTTGGCCGCAGGATCTGGCCTACGAGGCGTGGATCCGGCCACCGCGGCCTCTCCCCCGATCGTTGGCCGCTTCCTCCTCCA

Reverse complement sequence

TGGAGGAGGAAGCGGCCAACGATCGGGGGAGAGGCCGCGGTGGCCGGATCCACGCCTCGTAGGCCAGATCCTGCGGCCAACGATCGGGAGGCGGGGAGGC[G/A]
TCAGCGGCCGGCGCTTGGGAGGGGGGCCACAGCCTGATCTGTGAGGGAGAGAGTGATGATGGAGAGAAGGAAGATGAGGGAGAGAGAGTAAGGGAGGGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.10% 24.20% 0.25% 12.40% NA
All Indica  2759 90.60% 1.30% 0.18% 7.94% NA
All Japonica  1512 6.50% 71.60% 0.20% 21.63% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 75.50% 0.70% 0.17% 23.70% NA
Indica II  465 95.50% 3.20% 0.43% 0.86% NA
Indica III  913 97.70% 0.10% 0.00% 2.19% NA
Indica Intermediate  786 91.00% 1.90% 0.25% 6.87% NA
Temperate Japonica  767 2.10% 74.80% 0.39% 22.69% NA
Tropical Japonica  504 6.50% 86.70% 0.00% 6.75% NA
Japonica Intermediate  241 20.70% 29.90% 0.00% 49.38% NA
VI/Aromatic  96 70.80% 0.00% 1.04% 28.12% NA
Intermediate  90 53.30% 28.90% 3.33% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016534305 C -> T LOC_Os10g31560.1 upstream_gene_variant ; 2753.0bp to feature; MODIFIER silent_mutation Average:64.482; most accessible tissue: Zhenshan97 young leaf, score: 86.542 N N N N
vg1016534305 C -> T LOC_Os10g31690.1 upstream_gene_variant ; 3429.0bp to feature; MODIFIER silent_mutation Average:64.482; most accessible tissue: Zhenshan97 young leaf, score: 86.542 N N N N
vg1016534305 C -> T LOC_Os10g31560-LOC_Os10g31690 intergenic_region ; MODIFIER silent_mutation Average:64.482; most accessible tissue: Zhenshan97 young leaf, score: 86.542 N N N N
vg1016534305 C -> DEL N N silent_mutation Average:64.482; most accessible tissue: Zhenshan97 young leaf, score: 86.542 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016534305 NA 3.26E-07 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 4.26E-08 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 8.48E-09 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 6.85E-07 6.85E-07 mr1191 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 9.12E-08 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 5.35E-10 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 2.18E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 1.05E-07 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 4.83E-07 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 7.87E-08 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 1.80E-06 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 1.86E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 4.98E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 8.95E-10 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 5.44E-08 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 1.64E-07 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 3.08E-08 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 2.60E-19 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 8.64E-06 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 9.29E-17 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 2.59E-07 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 3.75E-07 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 2.90E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016534305 NA 1.07E-07 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251