\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016528653:

Variant ID: vg1016528653 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16528653
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.75, T: 0.25, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:


GATATTACCGCAGAGTGAAACCCCGCGCATTGCTGCGGGAATTTAGTATGATAACAAAAAAAATACCGTATAAGATAGTTAGATAACATCAGATTAAGTA[A/T]
ATTAATGTGATTTATGATAATTTAAATTTAAATAGTATGTAGAATGGTGATTCAAATGTAAAAAGTAAGCTGGTATAACTTTATGAAAGAAGAAAAGTAG

Reverse complement sequence

CTACTTTTCTTCTTTCATAAAGTTATACCAGCTTACTTTTTACATTTGAATCACCATTCTACATACTATTTAAATTTAAATTATCATAAATCACATTAAT[T/A]
TACTTAATCTGATGTTATCTAACTATCTTATACGGTATTTTTTTTGTTATCATACTAAATTCCCGCAGCAATGCGCGGGGTTTCACTCTGCGGTAATATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.50% 37.90% 1.31% 11.32% NA
All Indica  2759 79.70% 12.20% 0.29% 7.79% NA
All Japonica  1512 5.90% 72.00% 1.52% 20.57% NA
Aus  269 5.20% 94.80% 0.00% 0.00% NA
Indica I  595 59.80% 15.80% 0.50% 23.87% NA
Indica II  465 94.00% 4.90% 0.22% 0.86% NA
Indica III  913 85.20% 12.80% 0.00% 1.97% NA
Indica Intermediate  786 79.90% 13.10% 0.51% 6.49% NA
Temperate Japonica  767 1.80% 74.80% 2.09% 21.25% NA
Tropical Japonica  504 5.60% 87.70% 0.00% 6.75% NA
Japonica Intermediate  241 19.50% 30.30% 2.90% 47.30% NA
VI/Aromatic  96 3.10% 68.80% 27.08% 1.04% NA
Intermediate  90 37.80% 47.80% 5.56% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016528653 A -> T LOC_Os10g31560.1 downstream_gene_variant ; 2330.0bp to feature; MODIFIER silent_mutation Average:49.539; most accessible tissue: Zhenshan97 root, score: 85.556 N N N N
vg1016528653 A -> T LOC_Os10g31550-LOC_Os10g31560 intergenic_region ; MODIFIER silent_mutation Average:49.539; most accessible tissue: Zhenshan97 root, score: 85.556 N N N N
vg1016528653 A -> DEL N N silent_mutation Average:49.539; most accessible tissue: Zhenshan97 root, score: 85.556 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016528653 NA 6.63E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016528653 NA 9.96E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016528653 9.21E-06 2.19E-06 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016528653 NA 6.56E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016528653 NA 9.31E-06 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016528653 NA 2.26E-14 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016528653 NA 1.84E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016528653 NA 2.12E-10 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016528653 NA 1.55E-06 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016528653 NA 4.56E-13 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016528653 NA 3.74E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016528653 NA 4.78E-13 mr1524 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016528653 NA 2.21E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016528653 NA 8.61E-09 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016528653 NA 1.56E-09 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016528653 NA 1.01E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016528653 NA 1.80E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016528653 2.42E-06 4.96E-10 mr1761 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016528653 NA 9.96E-08 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016528653 NA 5.66E-08 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251