\
| Variant ID: vg1016522376 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 16522376 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 116. )
ATATGCCTGAGGTCAAAACGGGCTACCCGGATGCCAGCGCTACCTCCTCACCATTCTGTCCTCGTAGTCACCGTCGTCGGTCATGGGAAATCATGCAGCC[G/A]
TGAGGATAGCAGTGGCAGGGCCTCCTTTTTCCATGCCCTCGAAAATTTTCTCTTGGCATGGCGAGGTTGGCGTGGCGGATCTCGCCGTTCGAGATGGGCT
AGCCCATCTCGAACGGCGAGATCCGCCACGCCAACCTCGCCATGCCAAGAGAAAATTTTCGAGGGCATGGAAAAAGGAGGCCCTGCCACTGCTATCCTCA[C/T]
GGCTGCATGATTTCCCATGACCGACGACGGTGACTACGAGGACAGAATGGTGAGGAGGTAGCGCTGGCATCCGGGTAGCCCGTTTTGACCTCAGGCATAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.00% | 38.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 88.90% | 11.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 6.50% | 93.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 71.10% | 28.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.00% | 11.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 6.30% | 93.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 20.70% | 79.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 69.80% | 30.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 48.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1016522376 | G -> A | LOC_Os10g31540.1 | upstream_gene_variant ; 2718.0bp to feature; MODIFIER | silent_mutation | Average:52.142; most accessible tissue: Zhenshan97 young leaf, score: 74.675 | N | N | N | N |
| vg1016522376 | G -> A | LOC_Os10g31550.1 | downstream_gene_variant ; 122.0bp to feature; MODIFIER | silent_mutation | Average:52.142; most accessible tissue: Zhenshan97 young leaf, score: 74.675 | N | N | N | N |
| vg1016522376 | G -> A | LOC_Os10g31540-LOC_Os10g31550 | intergenic_region ; MODIFIER | silent_mutation | Average:52.142; most accessible tissue: Zhenshan97 young leaf, score: 74.675 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1016522376 | NA | 9.86E-07 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | NA | 1.25E-07 | mr1080 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | 7.93E-06 | NA | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | NA | 1.37E-08 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | NA | 3.70E-07 | mr1203 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | NA | 4.69E-07 | mr1395 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | NA | 5.40E-07 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | NA | 1.11E-07 | mr1618 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | NA | 9.68E-06 | mr1619 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | NA | 4.65E-10 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | NA | 5.01E-09 | mr1913 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | NA | 8.38E-11 | mr1071_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | NA | 5.71E-11 | mr1080_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | NA | 5.32E-07 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | NA | 4.48E-11 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | NA | 7.50E-18 | mr1336_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | NA | 1.57E-07 | mr1402_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | NA | 2.47E-17 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | NA | 4.34E-09 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | 4.66E-06 | 9.04E-10 | mr1619_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | NA | 4.49E-17 | mr1715_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | NA | 4.84E-10 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016522376 | NA | 2.25E-07 | mr1962_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |