Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016503494:

Variant ID: vg1016503494 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16503494
Reference Allele: T	Alternative Allele: C,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.30, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:

GATTTGGATTTGACTATTTAGCTAACAGTATATGTGGGCAAAGGAAAGGAATTGGATCGTCATTTCTACGGCAGAGGTACAGCAGCTTGTATATATATAT[T/C,A]
TAATATTTGTACCCACCATTATGTGGTAAATATCGAGAAAAAAGTAATCTGTGATAAATTACAGATCCAAATTAAATACTACAATTAATATTTGCCATGG

Reverse complement sequence

CCATGGCAAATATTAATTGTAGTATTTAATTTGGATCTGTAATTTATCACAGATTACTTTTTTCTCGATATTTACCACATAATGGTGGGTACAAATATTA[A/G,T]
ATATATATATACAAGCTGCTGTACCTCTGCCGTAGAAATGACGATCCAATTCCTTTCCTTTGCCCACATATACTGTTAGCTAAATAGTCAAATCCAAATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.60%	28.20%	0.04%	0.00%	A: 4.08%
All Indica	2759	98.40%	1.50%	0.00%	0.00%	A: 0.11%
All Japonica	1512	6.40%	81.20%	0.07%	0.00%	A: 12.37%
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.50%	0.30%	0.00%	0.00%	A: 0.17%
Indica II	465	96.10%	3.90%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	97.20%	2.50%	0.00%	0.00%	A: 0.25%
Temperate Japonica	767	2.00%	89.60%	0.13%	0.00%	A: 8.34%
Tropical Japonica	504	6.30%	87.50%	0.00%	0.00%	A: 6.15%
Japonica Intermediate	241	20.70%	41.10%	0.00%	0.00%	A: 38.17%
VI/Aromatic	96	68.80%	31.20%	0.00%	0.00%	NA
Intermediate	90	55.60%	40.00%	1.11%	0.00%	A: 3.33%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016503494	T -> C	LOC_Os10g31500.1	upstream_gene_variant ; 1754.0bp to feature; MODIFIER	silent_mutation	Average:40.478; most accessible tissue: Callus, score: 76.253	N	N	N	N
vg1016503494	T -> C	LOC_Os10g31510.1	downstream_gene_variant ; 3992.0bp to feature; MODIFIER	silent_mutation	Average:40.478; most accessible tissue: Callus, score: 76.253	N	N	N	N
vg1016503494	T -> C	LOC_Os10g31500-LOC_Os10g31510	intergenic_region ; MODIFIER	silent_mutation	Average:40.478; most accessible tissue: Callus, score: 76.253	N	N	N	N
vg1016503494	T -> A	LOC_Os10g31500.1	upstream_gene_variant ; 1754.0bp to feature; MODIFIER	silent_mutation	Average:40.478; most accessible tissue: Callus, score: 76.253	N	N	N	N
vg1016503494	T -> A	LOC_Os10g31510.1	downstream_gene_variant ; 3992.0bp to feature; MODIFIER	silent_mutation	Average:40.478; most accessible tissue: Callus, score: 76.253	N	N	N	N
vg1016503494	T -> A	LOC_Os10g31500-LOC_Os10g31510	intergenic_region ; MODIFIER	silent_mutation	Average:40.478; most accessible tissue: Callus, score: 76.253	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016503494	NA	6.13E-07	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016503494	NA	3.22E-06	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016503494	1.54E-07	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016503494	NA	4.85E-10	mr1071_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016503494	3.61E-07	NA	mr1080_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016503494	NA	4.53E-10	mr1080_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016503494	NA	3.29E-08	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016503494	3.07E-07	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016503494	NA	4.39E-10	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016503494	NA	3.30E-12	mr1553_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016503494	NA	3.80E-10	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016503494	4.80E-07	NA	mr1619_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016503494	5.80E-06	1.91E-09	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016503494	NA	4.02E-12	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016503494	NA	5.68E-06	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016503494	NA	1.91E-08	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016503494	NA	2.30E-08	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251