Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016496199:

Variant ID: vg1016496199 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16496199
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

GTCAAAATTGACGGTTTTACTCCATTAAAAATTTGGGGGAAAAAACCTAGGCAAAATTGGTTATATAGCATCGAAAGTTCGCGTTTTTGGTTTTATAGCA[T/C]
CGAAAGATATCGGTTCACTTTAATAGCATCCAAAGTTCACCCTGATCCAATTTTTAACACTTCCATCAATTCTCGATCGTTTTCCGTCCGCCTTGATTGC

Reverse complement sequence

GCAATCAAGGCGGACGGAAAACGATCGAGAATTGATGGAAGTGTTAAAAATTGGATCAGGGTGAACTTTGGATGCTATTAAAGTGAACCGATATCTTTCG[A/G]
TGCTATAAAACCAAAAACGCGAACTTTCGATGCTATATAACCAATTTTGCCTAGGTTTTTTCCCCCAAATTTTTAATGGAGTAAAACCGTCAATTTTGAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.00%	17.00%	0.00%	0.00%	NA
All Indica	2759	97.50%	2.50%	0.00%	0.00%	NA
All Japonica	1512	52.60%	47.40%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	95.80%	4.20%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	95.70%	4.30%	0.00%	0.00%	NA
Temperate Japonica	767	12.90%	87.10%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	82.60%	17.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016496199	T -> C	LOC_Os10g31460.1	upstream_gene_variant ; 961.0bp to feature; MODIFIER	silent_mutation	Average:43.433; most accessible tissue: Callus, score: 71.393	N	N	N	N
vg1016496199	T -> C	LOC_Os10g31460.2	upstream_gene_variant ; 4192.0bp to feature; MODIFIER	silent_mutation	Average:43.433; most accessible tissue: Callus, score: 71.393	N	N	N	N
vg1016496199	T -> C	LOC_Os10g31490.1	downstream_gene_variant ; 1521.0bp to feature; MODIFIER	silent_mutation	Average:43.433; most accessible tissue: Callus, score: 71.393	N	N	N	N
vg1016496199	T -> C	LOC_Os10g31500.1	downstream_gene_variant ; 4461.0bp to feature; MODIFIER	silent_mutation	Average:43.433; most accessible tissue: Callus, score: 71.393	N	N	N	N
vg1016496199	T -> C	LOC_Os10g31460-LOC_Os10g31490	intergenic_region ; MODIFIER	silent_mutation	Average:43.433; most accessible tissue: Callus, score: 71.393	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016496199	NA	1.74E-13	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	6.49E-07	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	4.52E-16	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	9.92E-08	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	2.60E-16	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	1.60E-07	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	2.52E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	1.26E-39	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	4.24E-11	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	1.10E-07	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	2.36E-06	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	4.42E-07	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	5.36E-33	mr1789	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	8.06E-14	mr1789	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	6.28E-08	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	9.38E-16	mr1879	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	8.24E-13	mr1879	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	1.32E-09	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	1.89E-13	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	8.81E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	1.50E-12	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016496199	NA	5.85E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251