\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016434902:

Variant ID: vg1016434902 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16434902
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


GAACGGTCAAACATGTTTAAAAAAATCAACAGCGTCAAACATTTAGGGATGGAGGGAGCACATTTTAGCCAACAACCACAAAAATGTCCTAAGCCAAAAC[C/G]
ATAAAAGGGTGTCATATGTAGCAAACAAGTGTGTATCCGAGCAAATTTTACCATATGTTTGCTTATGCTTATACTTATCAGCCAAAAATTAAATTTTCAA

Reverse complement sequence

TTGAAAATTTAATTTTTGGCTGATAAGTATAAGCATAAGCAAACATATGGTAAAATTTGCTCGGATACACACTTGTTTGCTACATATGACACCCTTTTAT[G/C]
GTTTTGGCTTAGGACATTTTTGTGGTTGTTGGCTAAAATGTGCTCCCTCCATCCCTAAATGTTTGACGCTGTTGATTTTTTTAAACATGTTTGACCGTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.60% 31.40% 0.02% 0.00% NA
All Indica  2759 86.90% 13.00% 0.04% 0.00% NA
All Japonica  1512 51.00% 49.00% 0.00% 0.00% NA
Aus  269 5.60% 94.40% 0.00% 0.00% NA
Indica I  595 77.80% 22.00% 0.17% 0.00% NA
Indica II  465 94.20% 5.80% 0.00% 0.00% NA
Indica III  913 88.00% 12.00% 0.00% 0.00% NA
Indica Intermediate  786 88.30% 11.70% 0.00% 0.00% NA
Temperate Japonica  767 12.10% 87.90% 0.00% 0.00% NA
Tropical Japonica  504 96.80% 3.20% 0.00% 0.00% NA
Japonica Intermediate  241 78.80% 21.20% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016434902 C -> G LOC_Os10g31330.1 upstream_gene_variant ; 4811.0bp to feature; MODIFIER silent_mutation Average:18.606; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg1016434902 C -> G LOC_Os10g31340.1 upstream_gene_variant ; 3246.0bp to feature; MODIFIER silent_mutation Average:18.606; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg1016434902 C -> G LOC_Os10g31330.2 upstream_gene_variant ; 4811.0bp to feature; MODIFIER silent_mutation Average:18.606; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg1016434902 C -> G LOC_Os10g31330.3 upstream_gene_variant ; 4811.0bp to feature; MODIFIER silent_mutation Average:18.606; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg1016434902 C -> G LOC_Os10g31330.5 upstream_gene_variant ; 4811.0bp to feature; MODIFIER silent_mutation Average:18.606; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg1016434902 C -> G LOC_Os10g31330.6 upstream_gene_variant ; 4811.0bp to feature; MODIFIER silent_mutation Average:18.606; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg1016434902 C -> G LOC_Os10g31330-LOC_Os10g31340 intergenic_region ; MODIFIER silent_mutation Average:18.606; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016434902 NA 2.85E-07 mr1002 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016434902 2.18E-06 2.18E-06 mr1110 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016434902 NA 1.79E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016434902 NA 2.43E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016434902 NA 5.80E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251