Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1016434902:

Variant ID: vg1016434902 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16434902
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

GAACGGTCAAACATGTTTAAAAAAATCAACAGCGTCAAACATTTAGGGATGGAGGGAGCACATTTTAGCCAACAACCACAAAAATGTCCTAAGCCAAAAC[C/G]
ATAAAAGGGTGTCATATGTAGCAAACAAGTGTGTATCCGAGCAAATTTTACCATATGTTTGCTTATGCTTATACTTATCAGCCAAAAATTAAATTTTCAA

Reverse complement sequence

TTGAAAATTTAATTTTTGGCTGATAAGTATAAGCATAAGCAAACATATGGTAAAATTTGCTCGGATACACACTTGTTTGCTACATATGACACCCTTTTAT[G/C]
GTTTTGGCTTAGGACATTTTTGTGGTTGTTGGCTAAAATGTGCTCCCTCCATCCCTAAATGTTTGACGCTGTTGATTTTTTTAAACATGTTTGACCGTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.60%	31.40%	0.02%	0.00%	NA
All Indica	2759	86.90%	13.00%	0.04%	0.00%	NA
All Japonica	1512	51.00%	49.00%	0.00%	0.00%	NA
Aus	269	5.60%	94.40%	0.00%	0.00%	NA
Indica I	595	77.80%	22.00%	0.17%	0.00%	NA
Indica II	465	94.20%	5.80%	0.00%	0.00%	NA
Indica III	913	88.00%	12.00%	0.00%	0.00%	NA
Indica Intermediate	786	88.30%	11.70%	0.00%	0.00%	NA
Temperate Japonica	767	12.10%	87.90%	0.00%	0.00%	NA
Tropical Japonica	504	96.80%	3.20%	0.00%	0.00%	NA
Japonica Intermediate	241	78.80%	21.20%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	62.20%	37.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016434902	C -> G	LOC_Os10g31330.1	upstream_gene_variant ; 4811.0bp to feature; MODIFIER	silent_mutation	Average:18.606; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg1016434902	C -> G	LOC_Os10g31340.1	upstream_gene_variant ; 3246.0bp to feature; MODIFIER	silent_mutation	Average:18.606; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg1016434902	C -> G	LOC_Os10g31330.2	upstream_gene_variant ; 4811.0bp to feature; MODIFIER	silent_mutation	Average:18.606; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg1016434902	C -> G	LOC_Os10g31330.3	upstream_gene_variant ; 4811.0bp to feature; MODIFIER	silent_mutation	Average:18.606; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg1016434902	C -> G	LOC_Os10g31330.5	upstream_gene_variant ; 4811.0bp to feature; MODIFIER	silent_mutation	Average:18.606; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg1016434902	C -> G	LOC_Os10g31330.6	upstream_gene_variant ; 4811.0bp to feature; MODIFIER	silent_mutation	Average:18.606; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg1016434902	C -> G	LOC_Os10g31330-LOC_Os10g31340	intergenic_region ; MODIFIER	silent_mutation	Average:18.606; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016434902	NA	2.85E-07	mr1002	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016434902	2.18E-06	2.18E-06	mr1110	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016434902	NA	1.79E-07	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016434902	NA	2.43E-06	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016434902	NA	5.80E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251