\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016430707:

Variant ID: vg1016430707 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16430707
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGCATGGTAAGTTATTATCTCAGTTATTCTTTTTCATCCCTAGATCGGCATTTCTTACTACTTACCAGTATTGTGTTACATGTATACATGATCTGATT[C/T]
CGACTTAAATGCAGCATTTTAAACCGATCTAGACCTACATGTTAAGTGAGCCTGGCGACATACTTCCTCCGTTTCATAATGCAAGTCTTTTTTAGCATAT

Reverse complement sequence

ATATGCTAAAAAAGACTTGCATTATGAAACGGAGGAAGTATGTCGCCAGGCTCACTTAACATGTAGGTCTAGATCGGTTTAAAATGCTGCATTTAAGTCG[G/A]
AATCAGATCATGTATACATGTAACACAATACTGGTAAGTAGTAAGAAATGCCGATCTAGGGATGAAAAAGAATAACTGAGATAATAACTTACCATGCAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.30% 31.50% 1.40% 17.73% NA
All Indica  2759 58.40% 13.30% 1.99% 26.28% NA
All Japonica  1512 44.00% 48.90% 0.40% 6.61% NA
Aus  269 5.20% 94.10% 0.00% 0.74% NA
Indica I  595 49.10% 22.40% 5.21% 23.36% NA
Indica II  465 60.20% 6.20% 1.08% 32.47% NA
Indica III  913 63.40% 12.00% 0.33% 24.21% NA
Indica Intermediate  786 58.50% 12.20% 2.04% 27.23% NA
Temperate Japonica  767 11.10% 87.70% 0.00% 1.17% NA
Tropical Japonica  504 81.30% 3.00% 0.99% 14.68% NA
Japonica Intermediate  241 71.00% 21.60% 0.41% 7.05% NA
VI/Aromatic  96 2.10% 96.90% 0.00% 1.04% NA
Intermediate  90 43.30% 40.00% 5.56% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016430707 C -> T LOC_Os10g31320.1 upstream_gene_variant ; 3776.0bp to feature; MODIFIER silent_mutation Average:26.249; most accessible tissue: Callus, score: 85.365 N N N N
vg1016430707 C -> T LOC_Os10g31330.1 upstream_gene_variant ; 616.0bp to feature; MODIFIER silent_mutation Average:26.249; most accessible tissue: Callus, score: 85.365 N N N N
vg1016430707 C -> T LOC_Os10g31320.2 upstream_gene_variant ; 3779.0bp to feature; MODIFIER silent_mutation Average:26.249; most accessible tissue: Callus, score: 85.365 N N N N
vg1016430707 C -> T LOC_Os10g31330.2 upstream_gene_variant ; 616.0bp to feature; MODIFIER silent_mutation Average:26.249; most accessible tissue: Callus, score: 85.365 N N N N
vg1016430707 C -> T LOC_Os10g31330.3 upstream_gene_variant ; 616.0bp to feature; MODIFIER silent_mutation Average:26.249; most accessible tissue: Callus, score: 85.365 N N N N
vg1016430707 C -> T LOC_Os10g31330.5 upstream_gene_variant ; 616.0bp to feature; MODIFIER silent_mutation Average:26.249; most accessible tissue: Callus, score: 85.365 N N N N
vg1016430707 C -> T LOC_Os10g31330.6 upstream_gene_variant ; 616.0bp to feature; MODIFIER silent_mutation Average:26.249; most accessible tissue: Callus, score: 85.365 N N N N
vg1016430707 C -> T LOC_Os10g31330-LOC_Os10g31340 intergenic_region ; MODIFIER silent_mutation Average:26.249; most accessible tissue: Callus, score: 85.365 N N N N
vg1016430707 C -> DEL N N silent_mutation Average:26.249; most accessible tissue: Callus, score: 85.365 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016430707 NA 2.34E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 NA 5.42E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 NA 8.50E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 NA 9.91E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 NA 5.95E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 NA 2.04E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 NA 1.42E-07 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 NA 2.14E-08 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 NA 1.23E-11 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 NA 8.67E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 NA 5.27E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 NA 1.75E-13 mr1789 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 7.51E-06 7.51E-06 mr1181_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 NA 4.08E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 NA 2.71E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 NA 2.10E-07 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 NA 7.64E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 NA 7.06E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 NA 1.56E-08 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 5.31E-06 5.84E-07 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 9.22E-06 9.22E-06 mr1983_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707 2.02E-08 2.02E-08 mr1984_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251