Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016430707:

Variant ID: vg1016430707 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16430707
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

ATTGCATGGTAAGTTATTATCTCAGTTATTCTTTTTCATCCCTAGATCGGCATTTCTTACTACTTACCAGTATTGTGTTACATGTATACATGATCTGATT[C/T]
CGACTTAAATGCAGCATTTTAAACCGATCTAGACCTACATGTTAAGTGAGCCTGGCGACATACTTCCTCCGTTTCATAATGCAAGTCTTTTTTAGCATAT

Reverse complement sequence

ATATGCTAAAAAAGACTTGCATTATGAAACGGAGGAAGTATGTCGCCAGGCTCACTTAACATGTAGGTCTAGATCGGTTTAAAATGCTGCATTTAAGTCG[G/A]
AATCAGATCATGTATACATGTAACACAATACTGGTAAGTAGTAAGAAATGCCGATCTAGGGATGAAAAAGAATAACTGAGATAATAACTTACCATGCAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.30%	31.50%	1.40%	17.73%	NA
All Indica	2759	58.40%	13.30%	1.99%	26.28%	NA
All Japonica	1512	44.00%	48.90%	0.40%	6.61%	NA
Aus	269	5.20%	94.10%	0.00%	0.74%	NA
Indica I	595	49.10%	22.40%	5.21%	23.36%	NA
Indica II	465	60.20%	6.20%	1.08%	32.47%	NA
Indica III	913	63.40%	12.00%	0.33%	24.21%	NA
Indica Intermediate	786	58.50%	12.20%	2.04%	27.23%	NA
Temperate Japonica	767	11.10%	87.70%	0.00%	1.17%	NA
Tropical Japonica	504	81.30%	3.00%	0.99%	14.68%	NA
Japonica Intermediate	241	71.00%	21.60%	0.41%	7.05%	NA
VI/Aromatic	96	2.10%	96.90%	0.00%	1.04%	NA
Intermediate	90	43.30%	40.00%	5.56%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016430707	C -> T	LOC_Os10g31320.1	upstream_gene_variant ; 3776.0bp to feature; MODIFIER	silent_mutation	Average:26.249; most accessible tissue: Callus, score: 85.365	N	N	N	N
vg1016430707	C -> T	LOC_Os10g31330.1	upstream_gene_variant ; 616.0bp to feature; MODIFIER	silent_mutation	Average:26.249; most accessible tissue: Callus, score: 85.365	N	N	N	N
vg1016430707	C -> T	LOC_Os10g31320.2	upstream_gene_variant ; 3779.0bp to feature; MODIFIER	silent_mutation	Average:26.249; most accessible tissue: Callus, score: 85.365	N	N	N	N
vg1016430707	C -> T	LOC_Os10g31330.2	upstream_gene_variant ; 616.0bp to feature; MODIFIER	silent_mutation	Average:26.249; most accessible tissue: Callus, score: 85.365	N	N	N	N
vg1016430707	C -> T	LOC_Os10g31330.3	upstream_gene_variant ; 616.0bp to feature; MODIFIER	silent_mutation	Average:26.249; most accessible tissue: Callus, score: 85.365	N	N	N	N
vg1016430707	C -> T	LOC_Os10g31330.5	upstream_gene_variant ; 616.0bp to feature; MODIFIER	silent_mutation	Average:26.249; most accessible tissue: Callus, score: 85.365	N	N	N	N
vg1016430707	C -> T	LOC_Os10g31330.6	upstream_gene_variant ; 616.0bp to feature; MODIFIER	silent_mutation	Average:26.249; most accessible tissue: Callus, score: 85.365	N	N	N	N
vg1016430707	C -> T	LOC_Os10g31330-LOC_Os10g31340	intergenic_region ; MODIFIER	silent_mutation	Average:26.249; most accessible tissue: Callus, score: 85.365	N	N	N	N
vg1016430707	C -> DEL	N	N	silent_mutation	Average:26.249; most accessible tissue: Callus, score: 85.365	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016430707	NA	2.34E-07	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	NA	5.42E-08	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	NA	8.50E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	NA	9.91E-08	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	NA	5.95E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	NA	2.04E-10	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	NA	1.42E-07	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	NA	2.14E-08	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	NA	1.23E-11	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	NA	8.67E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	NA	5.27E-13	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	NA	1.75E-13	mr1789	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	7.51E-06	7.51E-06	mr1181_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	NA	4.08E-07	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	NA	2.71E-10	mr1552_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	NA	2.10E-07	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	NA	7.64E-06	mr1663_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	NA	7.06E-06	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	NA	1.56E-08	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	5.31E-06	5.84E-07	mr1974_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	9.22E-06	9.22E-06	mr1983_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016430707	2.02E-08	2.02E-08	mr1984_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251