\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016429449:

Variant ID: vg1016429449 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16429449
Reference Allele: AAlternative Allele: G,C
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGAGCCATATCCAGAGCCAGAGCCAGAGCCGGAGCCTCCACCTTGGCCTCCACCGCCACCGCCACCGCCACCACTTCCATAACCACCACCATGAGCACC[A/G,C]
CCAGCACCCGACCCATAGCCGGAACCATAGCCAGACCCTTGCCCGTAGCCGCCAGCACCACCACCTTGGCCACCACCACCTCCGCCACCACTACCATACC

Reverse complement sequence

GGTATGGTAGTGGTGGCGGAGGTGGTGGTGGCCAAGGTGGTGGTGCTGGCGGCTACGGGCAAGGGTCTGGCTATGGTTCCGGCTATGGGTCGGGTGCTGG[T/C,G]
GGTGCTCATGGTGGTGGTTATGGAAGTGGTGGCGGTGGCGGTGGCGGTGGAGGCCAAGGTGGAGGCTCCGGCTCTGGCTCTGGCTCTGGATATGGCTCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.70% 4.50% 3.30% 0.00% C: 0.49%
All Indica  2759 88.80% 6.50% 4.17% 0.00% C: 0.58%
All Japonica  1512 95.40% 1.90% 2.51% 0.00% C: 0.26%
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 89.60% 3.20% 7.23% 0.00% NA
Indica II  465 86.70% 7.70% 5.38% 0.00% C: 0.22%
Indica III  913 89.40% 8.40% 1.42% 0.00% C: 0.77%
Indica Intermediate  786 88.70% 6.00% 4.33% 0.00% C: 1.02%
Temperate Japonica  767 95.30% 1.00% 3.65% 0.00% NA
Tropical Japonica  504 98.40% 1.00% 0.20% 0.00% C: 0.40%
Japonica Intermediate  241 89.20% 6.20% 3.73% 0.00% C: 0.83%
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 88.90% 4.40% 3.33% 0.00% C: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016429449 A -> C LOC_Os10g31330.1 synonymous_variant ; p.Gly172Gly; LOW synonymous_codon Average:90.546; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg1016429449 A -> C LOC_Os10g31330.2 synonymous_variant ; p.Gly159Gly; LOW synonymous_codon Average:90.546; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg1016429449 A -> C LOC_Os10g31330.5 synonymous_variant ; p.Gly156Gly; LOW synonymous_codon Average:90.546; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg1016429449 A -> C LOC_Os10g31330.6 synonymous_variant ; p.Gly150Gly; LOW synonymous_codon Average:90.546; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg1016429449 A -> G LOC_Os10g31330.1 synonymous_variant ; p.Gly172Gly; LOW synonymous_codon Average:90.546; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg1016429449 A -> G LOC_Os10g31330.2 synonymous_variant ; p.Gly159Gly; LOW synonymous_codon Average:90.546; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg1016429449 A -> G LOC_Os10g31330.5 synonymous_variant ; p.Gly156Gly; LOW synonymous_codon Average:90.546; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg1016429449 A -> G LOC_Os10g31330.6 synonymous_variant ; p.Gly150Gly; LOW synonymous_codon Average:90.546; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1016429449 A C 0.03 0.02 0.02 0.04 0.04 0.05
vg1016429449 A G -0.01 0.0 -0.01 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016429449 6.81E-06 NA mr1199_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016429449 6.31E-06 NA mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016429449 3.11E-06 NA mr1206_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016429449 5.41E-06 5.41E-06 mr1217_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016429449 8.66E-06 NA mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016429449 3.90E-06 3.90E-06 mr1259_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016429449 5.95E-08 5.95E-08 mr1307_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016429449 4.11E-07 4.11E-07 mr1382_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016429449 1.64E-06 8.50E-06 mr1720_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016429449 8.77E-06 8.77E-06 mr1777_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016429449 4.47E-06 NA mr1784_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016429449 1.79E-06 5.99E-06 mr1813_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016429449 2.88E-07 2.25E-06 mr1824_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016429449 1.86E-06 7.43E-06 mr1837_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016429449 7.78E-07 5.47E-06 mr1854_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016429449 8.12E-06 NA mr1862_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016429449 6.68E-06 NA mr1901_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251