\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016429377:

Variant ID: vg1016429377 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16429377
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TAACAACAGGCTATATTGTAGCTAGCTGATAGAGGAAATGAGCTTAGTGGTGTCCGTTGCCTCCGCCAGAGCCAGAGCCATATCCAGAGCCAGAGCCAGA[G/A]
CCGGAGCCTCCACCTTGGCCTCCACCGCCACCGCCACCGCCACCACTTCCATAACCACCACCATGAGCACCACCAGCACCCGACCCATAGCCGGAACCAT

Reverse complement sequence

ATGGTTCCGGCTATGGGTCGGGTGCTGGTGGTGCTCATGGTGGTGGTTATGGAAGTGGTGGCGGTGGCGGTGGCGGTGGAGGCCAAGGTGGAGGCTCCGG[C/T]
TCTGGCTCTGGCTCTGGATATGGCTCTGGCTCTGGCGGAGGCAACGGACACCACTAAGCTCATTTCCTCTATCAGCTAGCTACAATATAGCCTGTTGTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 49.10% 0.06% 0.00% NA
All Indica  2759 82.90% 17.10% 0.04% 0.00% NA
All Japonica  1512 4.60% 95.40% 0.00% 0.00% NA
Aus  269 2.20% 97.80% 0.00% 0.00% NA
Indica I  595 73.40% 26.40% 0.17% 0.00% NA
Indica II  465 92.70% 7.30% 0.00% 0.00% NA
Indica III  913 84.10% 15.90% 0.00% 0.00% NA
Indica Intermediate  786 82.80% 17.20% 0.00% 0.00% NA
Temperate Japonica  767 1.40% 98.60% 0.00% 0.00% NA
Tropical Japonica  504 5.20% 94.80% 0.00% 0.00% NA
Japonica Intermediate  241 13.70% 86.30% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 38.90% 58.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016429377 G -> A LOC_Os10g31330.1 synonymous_variant ; p.Gly196Gly; LOW synonymous_codon Average:88.18; most accessible tissue: Minghui63 flower, score: 93.6 N N N N
vg1016429377 G -> A LOC_Os10g31330.1 synonymous_variant ; p.Gly196Gly; LOW nonsynonymous_codon ; G196S Average:88.18; most accessible tissue: Minghui63 flower, score: 93.6 unknown unknown DELETERIOUS 0.03
vg1016429377 G -> A LOC_Os10g31330.2 synonymous_variant ; p.Gly183Gly; LOW synonymous_codon Average:88.18; most accessible tissue: Minghui63 flower, score: 93.6 N N N N
vg1016429377 G -> A LOC_Os10g31330.2 synonymous_variant ; p.Gly183Gly; LOW nonsynonymous_codon ; G183S Average:88.18; most accessible tissue: Minghui63 flower, score: 93.6 unknown unknown DELETERIOUS 0.02
vg1016429377 G -> A LOC_Os10g31330.5 synonymous_variant ; p.Gly180Gly; LOW synonymous_codon Average:88.18; most accessible tissue: Minghui63 flower, score: 93.6 N N N N
vg1016429377 G -> A LOC_Os10g31330.5 synonymous_variant ; p.Gly180Gly; LOW nonsynonymous_codon ; G180S Average:88.18; most accessible tissue: Minghui63 flower, score: 93.6 unknown unknown DELETERIOUS 0.03
vg1016429377 G -> A LOC_Os10g31330.6 synonymous_variant ; p.Gly174Gly; LOW synonymous_codon Average:88.18; most accessible tissue: Minghui63 flower, score: 93.6 N N N N
vg1016429377 G -> A LOC_Os10g31330.6 synonymous_variant ; p.Gly174Gly; LOW nonsynonymous_codon ; G174S Average:88.18; most accessible tissue: Minghui63 flower, score: 93.6 unknown unknown DELETERIOUS 0.03
vg1016429377 G -> A LOC_Os10g31330.3 non_coding_transcript_variant ; MODIFIER synonymous_codon Average:88.18; most accessible tissue: Minghui63 flower, score: 93.6 N N N N
vg1016429377 G -> A LOC_Os10g31330.3 non_coding_transcript_variant ; MODIFIER nonsynonymous_codon ; G157S Average:88.18; most accessible tissue: Minghui63 flower, score: 93.6 unknown unknown TOLERATED 0.06

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1016429377 G A -0.04 -0.05 -0.06 -0.04 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016429377 NA 7.23E-12 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016429377 NA 2.28E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016429377 NA 1.24E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016429377 4.09E-06 4.48E-09 mr1864_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016429377 3.65E-06 3.65E-06 mr1984_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251