Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016428635:

Variant ID: vg1016428635 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16428635
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATATGCAAATTTCATGACACACCCGATGTACCAAATAAACATGCAGAAACGAAGTTCCGAGAAATCAGCCGATCGATACCCTTCATGCTCTGGATCTT[G/T]
TGTTGAACGTACGTGTTACAGATATTTAAACGACTAACTGAACGTACGTAGAGTTAGAGATCGATATACTTCTACTAGCTAGAGGAGTAGTTAGTTTTGA

Reverse complement sequence

TCAAAACTAACTACTCCTCTAGCTAGTAGAAGTATATCGATCTCTAACTCTACGTACGTTCAGTTAGTCGTTTAAATATCTGTAACACGTACGTTCAACA[C/A]
AAGATCCAGAGCATGAAGGGTATCGATCGGCTGATTTCTCGGAACTTCGTTTCTGCATGTTTATTTGGTACATCGGGTGTGTCATGAAATTTGCATATTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.70%	2.80%	0.97%	21.54%	NA
All Indica	2759	88.60%	1.30%	0.25%	9.82%	NA
All Japonica	1512	66.30%	2.60%	2.25%	28.84%	NA
Aus	269	5.60%	15.60%	1.12%	77.70%	NA
Indica I	595	81.00%	2.50%	0.17%	16.30%	NA
Indica II	465	95.70%	0.40%	0.22%	3.66%	NA
Indica III	913	89.00%	1.20%	0.22%	9.53%	NA
Indica Intermediate	786	89.60%	1.10%	0.38%	8.91%	NA
Temperate Japonica	767	97.50%	0.50%	0.13%	1.83%	NA
Tropical Japonica	504	13.70%	6.50%	5.75%	74.01%	NA
Japonica Intermediate	241	76.80%	1.20%	1.66%	20.33%	NA
VI/Aromatic	96	5.20%	10.40%	2.08%	82.29%	NA
Intermediate	90	71.10%	3.30%	0.00%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016428635	G -> T	LOC_Os10g31320.1	upstream_gene_variant ; 1704.0bp to feature; MODIFIER	silent_mutation	Average:56.483; most accessible tissue: Callus, score: 77.488	N	N	N	N
vg1016428635	G -> T	LOC_Os10g31320.2	upstream_gene_variant ; 1707.0bp to feature; MODIFIER	silent_mutation	Average:56.483; most accessible tissue: Callus, score: 77.488	N	N	N	N
vg1016428635	G -> T	LOC_Os10g31310.1	downstream_gene_variant ; 4977.0bp to feature; MODIFIER	silent_mutation	Average:56.483; most accessible tissue: Callus, score: 77.488	N	N	N	N
vg1016428635	G -> T	LOC_Os10g31330.1	downstream_gene_variant ; 190.0bp to feature; MODIFIER	silent_mutation	Average:56.483; most accessible tissue: Callus, score: 77.488	N	N	N	N
vg1016428635	G -> T	LOC_Os10g31330.2	downstream_gene_variant ; 190.0bp to feature; MODIFIER	silent_mutation	Average:56.483; most accessible tissue: Callus, score: 77.488	N	N	N	N
vg1016428635	G -> T	LOC_Os10g31330.3	downstream_gene_variant ; 190.0bp to feature; MODIFIER	silent_mutation	Average:56.483; most accessible tissue: Callus, score: 77.488	N	N	N	N
vg1016428635	G -> T	LOC_Os10g31330.5	downstream_gene_variant ; 190.0bp to feature; MODIFIER	silent_mutation	Average:56.483; most accessible tissue: Callus, score: 77.488	N	N	N	N
vg1016428635	G -> T	LOC_Os10g31330.6	downstream_gene_variant ; 190.0bp to feature; MODIFIER	silent_mutation	Average:56.483; most accessible tissue: Callus, score: 77.488	N	N	N	N
vg1016428635	G -> T	LOC_Os10g31320-LOC_Os10g31330	intergenic_region ; MODIFIER	silent_mutation	Average:56.483; most accessible tissue: Callus, score: 77.488	N	N	N	N
vg1016428635	G -> DEL	N	N	silent_mutation	Average:56.483; most accessible tissue: Callus, score: 77.488	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016428635	NA	1.92E-06	Spikelet_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1016428635	NA	4.44E-08	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	1.04E-08	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	1.86E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	5.45E-09	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	2.95E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	8.21E-07	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	1.42E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	1.89E-14	mr1540	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	3.29E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	4.51E-07	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	8.15E-07	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	1.30E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	1.16E-08	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	1.98E-06	mr1725	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	3.42E-12	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	4.82E-12	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	1.33E-08	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	4.15E-07	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	6.52E-09	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	3.81E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	1.79E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	3.70E-06	mr1521_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	4.30E-12	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	2.34E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	1.12E-09	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	2.36E-06	NA	mr1653_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	1.08E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	1.95E-06	mr1735_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	6.37E-09	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	1.39E-10	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	4.47E-06	mr1974_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	6.09E-06	6.09E-06	mr1983_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	7.67E-07	7.67E-07	mr1984_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016428635	NA	1.20E-11	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251