Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016425716:

Variant ID: vg1016425716 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16425716
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

ATAGCTCCTTTGATTCCACCAGGATGAACACCTCCGAAAACAAAAAAACAACAACAAGAAGAAACCTTTCATTTCATTGAGCAATCAGAATCGAAGCAGA[C/T]
ATTCATGCTTACCTTTCATACAAGCATACAGCCTAGTGTTCAAAGCTTCAAAGAGTTTGCGCCAAATTGACCTTTCATTCAAGAACGAGAGAGATCTGAG

Reverse complement sequence

CTCAGATCTCTCTCGTTCTTGAATGAAAGGTCAATTTGGCGCAAACTCTTTGAAGCTTTGAACACTAGGCTGTATGCTTGTATGAAAGGTAAGCATGAAT[G/A]
TCTGCTTCGATTCTGATTGCTCAATGAAATGAAAGGTTTCTTCTTGTTGTTGTTTTTTTGTTTTCGGAGGTGTTCATCCTGGTGGAATCAAAGGAGCTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.50%	36.60%	0.55%	2.33%	NA
All Indica	2759	36.40%	59.00%	0.76%	3.77%	NA
All Japonica	1512	95.40%	4.20%	0.13%	0.20%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	33.60%	63.70%	1.01%	1.68%	NA
Indica II	465	25.20%	70.30%	0.43%	4.09%	NA
Indica III	913	42.40%	51.50%	1.10%	5.04%	NA
Indica Intermediate	786	38.30%	57.60%	0.38%	3.69%	NA
Temperate Japonica	767	98.70%	1.20%	0.00%	0.13%	NA
Tropical Japonica	504	94.80%	4.60%	0.20%	0.40%	NA
Japonica Intermediate	241	86.30%	13.30%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	61.10%	32.20%	3.33%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016425716	C -> T	LOC_Os10g31310.1	downstream_gene_variant ; 2058.0bp to feature; MODIFIER	silent_mutation	Average:57.625; most accessible tissue: Zhenshan97 flower, score: 77.755	N	N	N	N
vg1016425716	C -> T	LOC_Os10g31320.1	downstream_gene_variant ; 286.0bp to feature; MODIFIER	silent_mutation	Average:57.625; most accessible tissue: Zhenshan97 flower, score: 77.755	N	N	N	N
vg1016425716	C -> T	LOC_Os10g31330.1	downstream_gene_variant ; 3109.0bp to feature; MODIFIER	silent_mutation	Average:57.625; most accessible tissue: Zhenshan97 flower, score: 77.755	N	N	N	N
vg1016425716	C -> T	LOC_Os10g31320.2	downstream_gene_variant ; 286.0bp to feature; MODIFIER	silent_mutation	Average:57.625; most accessible tissue: Zhenshan97 flower, score: 77.755	N	N	N	N
vg1016425716	C -> T	LOC_Os10g31330.2	downstream_gene_variant ; 3109.0bp to feature; MODIFIER	silent_mutation	Average:57.625; most accessible tissue: Zhenshan97 flower, score: 77.755	N	N	N	N
vg1016425716	C -> T	LOC_Os10g31330.3	downstream_gene_variant ; 3109.0bp to feature; MODIFIER	silent_mutation	Average:57.625; most accessible tissue: Zhenshan97 flower, score: 77.755	N	N	N	N
vg1016425716	C -> T	LOC_Os10g31330.5	downstream_gene_variant ; 3109.0bp to feature; MODIFIER	silent_mutation	Average:57.625; most accessible tissue: Zhenshan97 flower, score: 77.755	N	N	N	N
vg1016425716	C -> T	LOC_Os10g31330.6	downstream_gene_variant ; 3109.0bp to feature; MODIFIER	silent_mutation	Average:57.625; most accessible tissue: Zhenshan97 flower, score: 77.755	N	N	N	N
vg1016425716	C -> T	LOC_Os10g31310-LOC_Os10g31320	intergenic_region ; MODIFIER	silent_mutation	Average:57.625; most accessible tissue: Zhenshan97 flower, score: 77.755	N	N	N	N
vg1016425716	C -> DEL	N	N	silent_mutation	Average:57.625; most accessible tissue: Zhenshan97 flower, score: 77.755	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016425716	NA	5.30E-09	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	1.57E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	4.44E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	5.31E-08	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	7.20E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	4.84E-08	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	1.41E-09	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	3.78E-13	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	1.36E-07	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	4.02E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	1.51E-06	mr1338	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	4.11E-09	mr1359	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	3.39E-07	mr1378	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	7.57E-07	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	5.11E-10	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	1.61E-06	1.61E-06	mr1520	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	2.84E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	2.77E-07	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	2.46E-08	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	2.22E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	6.87E-08	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	2.97E-06	mr1576	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	9.82E-06	mr1603	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	4.41E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	9.75E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	3.82E-06	2.30E-06	mr1641	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	2.64E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	5.67E-07	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	1.23E-08	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	5.63E-07	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	1.45E-06	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	2.41E-09	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	4.53E-06	mr1798	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	7.08E-07	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	1.03E-07	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	8.92E-06	mr1982	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016425716	NA	3.68E-08	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251