\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016395228:

Variant ID: vg1016395228 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16395228
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.09, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGAGTGTATAGGGGGCATGGGATTGATCGCGCGTAGCGATTGGGAGCAAGCGGAGTGATCGCGTGCGTGGGCTTTTTTCTATTTTACTGTTTCCTGAT[T/C]
GCTCATGCATCCGTCCCGTGATCACTCACGTATCAGGAGGACCCATCTTTAGTCCCGGTGTTAATTCAAAAAGAAAACATCTATATCCAAGTCAGATGTC

Reverse complement sequence

GACATCTGACTTGGATATAGATGTTTTCTTTTTGAATTAACACCGGGACTAAAGATGGGTCCTCCTGATACGTGAGTGATCACGGGACGGATGCATGAGC[A/G]
ATCAGGAAACAGTAAAATAGAAAAAAGCCCACGCACGCGATCACTCCGCTTGCTCCCAATCGCTACGCGCGATCAATCCCATGCCCCCTATACACTCCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.00% 16.00% 0.25% 49.79% NA
All Indica  2759 36.80% 1.10% 0.25% 61.91% NA
All Japonica  1512 15.70% 47.00% 0.20% 37.10% NA
Aus  269 97.40% 0.00% 0.00% 2.60% NA
Indica I  595 35.60% 1.00% 0.34% 63.03% NA
Indica II  465 23.40% 2.40% 0.00% 74.19% NA
Indica III  913 43.80% 0.10% 0.11% 55.97% NA
Indica Intermediate  786 37.40% 1.40% 0.51% 60.69% NA
Temperate Japonica  767 10.30% 85.80% 0.13% 3.78% NA
Tropical Japonica  504 8.50% 1.80% 0.20% 89.48% NA
Japonica Intermediate  241 48.10% 17.80% 0.41% 33.61% NA
VI/Aromatic  96 69.80% 0.00% 0.00% 30.21% NA
Intermediate  90 25.60% 18.90% 2.22% 53.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016395228 T -> C LOC_Os10g31250.1 upstream_gene_variant ; 1803.0bp to feature; MODIFIER silent_mutation Average:31.298; most accessible tissue: Callus, score: 66.245 N N N N
vg1016395228 T -> C LOC_Os10g31250-LOC_Os10g31280 intergenic_region ; MODIFIER silent_mutation Average:31.298; most accessible tissue: Callus, score: 66.245 N N N N
vg1016395228 T -> DEL N N silent_mutation Average:31.298; most accessible tissue: Callus, score: 66.245 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016395228 NA 3.31E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 1.38E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 2.34E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 7.71E-32 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 2.37E-09 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 2.87E-22 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 9.31E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 3.00E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 6.06E-06 1.44E-44 mr1486 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 4.07E-12 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 2.05E-07 3.35E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 2.62E-07 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 2.64E-23 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 5.63E-06 6.26E-08 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 3.24E-28 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 4.09E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 7.24E-07 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 1.76E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 1.17E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 5.96E-08 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 3.70E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 8.04E-13 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 1.65E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 8.16E-12 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016395228 NA 2.73E-09 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251