\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016390830:

Variant ID: vg1016390830 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 16390830
Reference Allele: GAlternative Allele: A,GAAATTAAAAAT
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAATTAGGAAATAACTGAAATTCGGAATTAAAAATAAGGAATATTAGAAATAGAGTATAGAGTCCATATAGAAATACAATTAGAAAATAACTGAAAATC[G/A,GAAATTAAAAAT]
AAATTAAAAATAAGGAATATTAGAAGTAGAGTATAGAGTCCATATAGAAATACAATTAAGAAAAAAAAATTCGGAATTAAAAAACAAAGAATATTAGAAG

Reverse complement sequence

CTTCTAATATTCTTTGTTTTTTAATTCCGAATTTTTTTTTCTTAATTGTATTTCTATATGGACTCTATACTCTACTTCTAATATTCCTTATTTTTAATTT[C/T,ATTTTTAATTTC]
GATTTTCAGTTATTTTCTAATTGTATTTCTATATGGACTCTATACTCTATTTCTAATATTCCTTATTTTTAATTCCGAATTTCAGTTATTTCCTAATTGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.80% 25.30% 27.13% 12.82% GAAATTAAAAAT: 0.97%
All Indica  2759 52.70% 5.90% 37.40% 2.43% GAAATTAAAAAT: 1.59%
All Japonica  1512 3.80% 61.80% 2.45% 31.88% GAAATTAAAAAT: 0.07%
Aus  269 13.80% 24.20% 56.13% 5.95% NA
Indica I  595 49.90% 3.50% 38.99% 6.05% GAAATTAAAAAT: 1.51%
Indica II  465 58.70% 7.70% 30.32% 2.58% GAAATTAAAAAT: 0.65%
Indica III  913 51.20% 5.90% 40.85% 0.22% GAAATTAAAAAT: 1.86%
Indica Intermediate  786 53.10% 6.50% 36.39% 2.16% GAAATTAAAAAT: 1.91%
Temperate Japonica  767 0.90% 96.10% 0.26% 2.74% NA
Tropical Japonica  504 4.00% 9.10% 5.16% 81.55% GAAATTAAAAAT: 0.20%
Japonica Intermediate  241 12.40% 63.10% 3.73% 20.75% NA
VI/Aromatic  96 16.70% 6.20% 47.92% 28.12% GAAATTAAAAAT: 1.04%
Intermediate  90 35.60% 31.10% 17.78% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016390830 G -> GAAATTAAAAAT LOC_Os10g31240.1 downstream_gene_variant ; 4038.0bp to feature; MODIFIER silent_mutation Average:13.583; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1016390830 G -> GAAATTAAAAAT LOC_Os10g31250.1 intron_variant ; MODIFIER silent_mutation Average:13.583; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1016390830 G -> A LOC_Os10g31240.1 downstream_gene_variant ; 4037.0bp to feature; MODIFIER silent_mutation Average:13.583; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1016390830 G -> A LOC_Os10g31250.1 intron_variant ; MODIFIER silent_mutation Average:13.583; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1016390830 G -> DEL N N silent_mutation Average:13.583; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016390830 NA 1.86E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016390830 NA 7.38E-08 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016390830 NA 3.38E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016390830 NA 7.21E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016390830 NA 3.34E-07 mr1671 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016390830 NA 2.05E-20 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016390830 NA 5.35E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251