\
| Variant ID: vg1016390830 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr10 | Position: 16390830 |
| Reference Allele: G | Alternative Allele: A,GAAATTAAAAAT |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACAATTAGGAAATAACTGAAATTCGGAATTAAAAATAAGGAATATTAGAAATAGAGTATAGAGTCCATATAGAAATACAATTAGAAAATAACTGAAAATC[G/A,GAAATTAAAAAT]
AAATTAAAAATAAGGAATATTAGAAGTAGAGTATAGAGTCCATATAGAAATACAATTAAGAAAAAAAAATTCGGAATTAAAAAACAAAGAATATTAGAAG
CTTCTAATATTCTTTGTTTTTTAATTCCGAATTTTTTTTTCTTAATTGTATTTCTATATGGACTCTATACTCTACTTCTAATATTCCTTATTTTTAATTT[C/T,ATTTTTAATTTC]
GATTTTCAGTTATTTTCTAATTGTATTTCTATATGGACTCTATACTCTATTTCTAATATTCCTTATTTTTAATTCCGAATTTCAGTTATTTCCTAATTGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.80% | 25.30% | 27.13% | 12.82% | GAAATTAAAAAT: 0.97% |
| All Indica | 2759 | 52.70% | 5.90% | 37.40% | 2.43% | GAAATTAAAAAT: 1.59% |
| All Japonica | 1512 | 3.80% | 61.80% | 2.45% | 31.88% | GAAATTAAAAAT: 0.07% |
| Aus | 269 | 13.80% | 24.20% | 56.13% | 5.95% | NA |
| Indica I | 595 | 49.90% | 3.50% | 38.99% | 6.05% | GAAATTAAAAAT: 1.51% |
| Indica II | 465 | 58.70% | 7.70% | 30.32% | 2.58% | GAAATTAAAAAT: 0.65% |
| Indica III | 913 | 51.20% | 5.90% | 40.85% | 0.22% | GAAATTAAAAAT: 1.86% |
| Indica Intermediate | 786 | 53.10% | 6.50% | 36.39% | 2.16% | GAAATTAAAAAT: 1.91% |
| Temperate Japonica | 767 | 0.90% | 96.10% | 0.26% | 2.74% | NA |
| Tropical Japonica | 504 | 4.00% | 9.10% | 5.16% | 81.55% | GAAATTAAAAAT: 0.20% |
| Japonica Intermediate | 241 | 12.40% | 63.10% | 3.73% | 20.75% | NA |
| VI/Aromatic | 96 | 16.70% | 6.20% | 47.92% | 28.12% | GAAATTAAAAAT: 1.04% |
| Intermediate | 90 | 35.60% | 31.10% | 17.78% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1016390830 | G -> GAAATTAAAAAT | LOC_Os10g31240.1 | downstream_gene_variant ; 4038.0bp to feature; MODIFIER | silent_mutation | Average:13.583; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1016390830 | G -> GAAATTAAAAAT | LOC_Os10g31250.1 | intron_variant ; MODIFIER | silent_mutation | Average:13.583; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1016390830 | G -> A | LOC_Os10g31240.1 | downstream_gene_variant ; 4037.0bp to feature; MODIFIER | silent_mutation | Average:13.583; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1016390830 | G -> A | LOC_Os10g31250.1 | intron_variant ; MODIFIER | silent_mutation | Average:13.583; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1016390830 | G -> DEL | N | N | silent_mutation | Average:13.583; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1016390830 | NA | 1.86E-13 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016390830 | NA | 7.38E-08 | mr1359 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016390830 | NA | 3.38E-06 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016390830 | NA | 7.21E-10 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016390830 | NA | 3.34E-07 | mr1671 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016390830 | NA | 2.05E-20 | mr1689 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016390830 | NA | 5.35E-06 | mr1704 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |