Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1016390830:

Variant ID: vg1016390830 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 16390830
Reference Allele: G	Alternative Allele: A,GAAATTAAAAAT
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACAATTAGGAAATAACTGAAATTCGGAATTAAAAATAAGGAATATTAGAAATAGAGTATAGAGTCCATATAGAAATACAATTAGAAAATAACTGAAAATC[G/A,GAAATTAAAAAT]
AAATTAAAAATAAGGAATATTAGAAGTAGAGTATAGAGTCCATATAGAAATACAATTAAGAAAAAAAAATTCGGAATTAAAAAACAAAGAATATTAGAAG

Reverse complement sequence

CTTCTAATATTCTTTGTTTTTTAATTCCGAATTTTTTTTTCTTAATTGTATTTCTATATGGACTCTATACTCTACTTCTAATATTCCTTATTTTTAATTT[C/T,ATTTTTAATTTC]
GATTTTCAGTTATTTTCTAATTGTATTTCTATATGGACTCTATACTCTATTTCTAATATTCCTTATTTTTAATTCCGAATTTCAGTTATTTCCTAATTGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.80%	25.30%	27.13%	12.82%	GAAATTAAAAAT: 0.97%
All Indica	2759	52.70%	5.90%	37.40%	2.43%	GAAATTAAAAAT: 1.59%
All Japonica	1512	3.80%	61.80%	2.45%	31.88%	GAAATTAAAAAT: 0.07%
Aus	269	13.80%	24.20%	56.13%	5.95%	NA
Indica I	595	49.90%	3.50%	38.99%	6.05%	GAAATTAAAAAT: 1.51%
Indica II	465	58.70%	7.70%	30.32%	2.58%	GAAATTAAAAAT: 0.65%
Indica III	913	51.20%	5.90%	40.85%	0.22%	GAAATTAAAAAT: 1.86%
Indica Intermediate	786	53.10%	6.50%	36.39%	2.16%	GAAATTAAAAAT: 1.91%
Temperate Japonica	767	0.90%	96.10%	0.26%	2.74%	NA
Tropical Japonica	504	4.00%	9.10%	5.16%	81.55%	GAAATTAAAAAT: 0.20%
Japonica Intermediate	241	12.40%	63.10%	3.73%	20.75%	NA
VI/Aromatic	96	16.70%	6.20%	47.92%	28.12%	GAAATTAAAAAT: 1.04%
Intermediate	90	35.60%	31.10%	17.78%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016390830	G -> GAAATTAAAAAT	LOC_Os10g31240.1	downstream_gene_variant ; 4038.0bp to feature; MODIFIER	silent_mutation	Average:13.583; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1016390830	G -> GAAATTAAAAAT	LOC_Os10g31250.1	intron_variant ; MODIFIER	silent_mutation	Average:13.583; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1016390830	G -> A	LOC_Os10g31240.1	downstream_gene_variant ; 4037.0bp to feature; MODIFIER	silent_mutation	Average:13.583; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1016390830	G -> A	LOC_Os10g31250.1	intron_variant ; MODIFIER	silent_mutation	Average:13.583; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1016390830	G -> DEL	N	N	silent_mutation	Average:13.583; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016390830	NA	1.86E-13	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016390830	NA	7.38E-08	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016390830	NA	3.38E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016390830	NA	7.21E-10	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016390830	NA	3.34E-07	mr1671	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016390830	NA	2.05E-20	mr1689	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016390830	NA	5.35E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251