\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016363331:

Variant ID: vg1016363331 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16363331
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


AGATCTGAGAAAGTTGTACAAACGTACGACTCCCTCCGTTTAAAAAACCCACCCTAAAACAACCAAATTTTGGATTGGTTTTTGGAGGATGGAAAAAGTA[T/C]
AATTACAGTGGTTGGAAAATTGACTACTCCTAGATTCCACCAGAGTACACGTGACCTGGTCAGGCTTGTTTTTTAATAAAGCAGCGCAGTTTAACAGTTC

Reverse complement sequence

GAACTGTTAAACTGCGCTGCTTTATTAAAAAACAAGCCTGACCAGGTCACGTGTACTCTGGTGGAATCTAGGAGTAGTCAATTTTCCAACCACTGTAATT[A/G]
TACTTTTTCCATCCTCCAAAAACCAATCCAAAATTTGGTTGTTTTAGGGTGGGTTTTTTAAACGGAGGGAGTCGTACGTTTGTACAACTTTCTCAGATCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.80% 15.80% 0.23% 41.09% NA
All Indica  2759 32.80% 1.30% 0.33% 65.53% NA
All Japonica  1512 49.60% 46.00% 0.07% 4.30% NA
Aus  269 97.80% 0.00% 0.00% 2.23% NA
Indica I  595 32.30% 1.30% 0.34% 66.05% NA
Indica II  465 23.00% 2.80% 0.22% 73.98% NA
Indica III  913 37.10% 0.00% 0.33% 62.54% NA
Indica Intermediate  786 34.00% 2.00% 0.38% 63.61% NA
Temperate Japonica  767 14.10% 84.60% 0.13% 1.17% NA
Tropical Japonica  504 94.20% 1.20% 0.00% 4.56% NA
Japonica Intermediate  241 69.30% 17.00% 0.00% 13.69% NA
VI/Aromatic  96 69.80% 0.00% 0.00% 30.21% NA
Intermediate  90 43.30% 17.80% 1.11% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016363331 T -> C LOC_Os10g31200.1 downstream_gene_variant ; 3743.0bp to feature; MODIFIER silent_mutation Average:50.161; most accessible tissue: Callus, score: 93.444 N N N N
vg1016363331 T -> C LOC_Os10g31200-LOC_Os10g31220 intergenic_region ; MODIFIER silent_mutation Average:50.161; most accessible tissue: Callus, score: 93.444 N N N N
vg1016363331 T -> DEL N N silent_mutation Average:50.161; most accessible tissue: Callus, score: 93.444 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1016363331 T C -0.09 -0.05 -0.03 0.03 -0.02 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016363331 NA 2.88E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363331 NA 1.33E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363331 NA 1.69E-14 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363331 NA 8.68E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363331 NA 4.68E-15 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363331 NA 1.12E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363331 NA 1.14E-24 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363331 NA 5.98E-38 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363331 NA 8.52E-11 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363331 NA 5.65E-07 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363331 NA 1.86E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363331 NA 2.55E-23 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363331 7.78E-06 3.59E-35 mr1789 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363331 NA 1.47E-13 mr1789 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363331 NA 5.15E-12 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363331 NA 6.04E-24 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363331 NA 1.29E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363331 NA 6.81E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363331 NA 7.26E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363331 NA 4.82E-14 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251