\
| Variant ID: vg1016349417 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 16349417 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 93. )
AAGTACTCCCTCCGTACTTTAAAAGCAAGTCGTTTAGGACAGCGACACGGTCTCTAAAACTCTTTTTTCTATAAAAATATTTATTGAAAAGTGATATATG[T/C]
ATACTTTTATGAAAGTATTTTTCAAGACAAATCTATTCATATAAATTTTATATTTTCTGTTGAGAGTTATTCATGATTTATATTTCTAAGGTTTGACTTA
TAAGTCAAACCTTAGAAATATAAATCATGAATAACTCTCAACAGAAAATATAAAATTTATATGAATAGATTTGTCTTGAAAAATACTTTCATAAAAGTAT[A/G]
CATATATCACTTTTCAATAAATATTTTTATAGAAAAAAGAGTTTTAGAGACCGTGTCGCTGTCCTAAACGACTTGCTTTTAAAGTACGGAGGGAGTACTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.30% | 5.90% | 0.55% | 52.29% | NA |
| All Indica | 2759 | 32.80% | 0.30% | 0.40% | 66.44% | NA |
| All Japonica | 1512 | 47.80% | 14.80% | 0.86% | 36.57% | NA |
| Aus | 269 | 82.50% | 14.90% | 0.00% | 2.60% | NA |
| Indica I | 595 | 32.80% | 0.20% | 0.50% | 66.55% | NA |
| Indica II | 465 | 23.70% | 0.20% | 0.00% | 76.13% | NA |
| Indica III | 913 | 36.90% | 0.00% | 0.44% | 62.65% | NA |
| Indica Intermediate | 786 | 33.60% | 0.90% | 0.51% | 65.01% | NA |
| Temperate Japonica | 767 | 84.60% | 11.50% | 0.00% | 3.91% | NA |
| Tropical Japonica | 504 | 4.80% | 5.80% | 2.38% | 87.10% | NA |
| Japonica Intermediate | 241 | 20.30% | 44.40% | 0.41% | 34.85% | NA |
| VI/Aromatic | 96 | 70.80% | 0.00% | 0.00% | 29.17% | NA |
| Intermediate | 90 | 37.80% | 4.40% | 2.22% | 55.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1016349417 | T -> C | LOC_Os10g31180-LOC_Os10g31189 | intergenic_region ; MODIFIER | silent_mutation | Average:25.913; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1016349417 | T -> DEL | N | N | silent_mutation | Average:25.913; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1016349417 | NA | 5.70E-06 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016349417 | NA | 1.09E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016349417 | NA | 1.01E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016349417 | NA | 5.89E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016349417 | NA | 8.24E-06 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016349417 | NA | 6.63E-07 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016349417 | 1.74E-06 | 2.95E-09 | mr1691 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016349417 | 2.17E-06 | 3.17E-12 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016349417 | NA | 4.66E-07 | mr1720 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016349417 | NA | 4.96E-07 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016349417 | NA | 1.62E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016349417 | NA | 5.69E-06 | mr1120_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016349417 | NA | 3.56E-06 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016349417 | NA | 4.90E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016349417 | NA | 1.42E-08 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |