\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016349417:

Variant ID: vg1016349417 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16349417
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTACTCCCTCCGTACTTTAAAAGCAAGTCGTTTAGGACAGCGACACGGTCTCTAAAACTCTTTTTTCTATAAAAATATTTATTGAAAAGTGATATATG[T/C]
ATACTTTTATGAAAGTATTTTTCAAGACAAATCTATTCATATAAATTTTATATTTTCTGTTGAGAGTTATTCATGATTTATATTTCTAAGGTTTGACTTA

Reverse complement sequence

TAAGTCAAACCTTAGAAATATAAATCATGAATAACTCTCAACAGAAAATATAAAATTTATATGAATAGATTTGTCTTGAAAAATACTTTCATAAAAGTAT[A/G]
CATATATCACTTTTCAATAAATATTTTTATAGAAAAAAGAGTTTTAGAGACCGTGTCGCTGTCCTAAACGACTTGCTTTTAAAGTACGGAGGGAGTACTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.30% 5.90% 0.55% 52.29% NA
All Indica  2759 32.80% 0.30% 0.40% 66.44% NA
All Japonica  1512 47.80% 14.80% 0.86% 36.57% NA
Aus  269 82.50% 14.90% 0.00% 2.60% NA
Indica I  595 32.80% 0.20% 0.50% 66.55% NA
Indica II  465 23.70% 0.20% 0.00% 76.13% NA
Indica III  913 36.90% 0.00% 0.44% 62.65% NA
Indica Intermediate  786 33.60% 0.90% 0.51% 65.01% NA
Temperate Japonica  767 84.60% 11.50% 0.00% 3.91% NA
Tropical Japonica  504 4.80% 5.80% 2.38% 87.10% NA
Japonica Intermediate  241 20.30% 44.40% 0.41% 34.85% NA
VI/Aromatic  96 70.80% 0.00% 0.00% 29.17% NA
Intermediate  90 37.80% 4.40% 2.22% 55.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016349417 T -> C LOC_Os10g31180-LOC_Os10g31189 intergenic_region ; MODIFIER silent_mutation Average:25.913; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1016349417 T -> DEL N N silent_mutation Average:25.913; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016349417 NA 5.70E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016349417 NA 1.09E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016349417 NA 1.01E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016349417 NA 5.89E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016349417 NA 8.24E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016349417 NA 6.63E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016349417 1.74E-06 2.95E-09 mr1691 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016349417 2.17E-06 3.17E-12 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016349417 NA 4.66E-07 mr1720 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016349417 NA 4.96E-07 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016349417 NA 1.62E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016349417 NA 5.69E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016349417 NA 3.56E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016349417 NA 4.90E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016349417 NA 1.42E-08 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251