\
| Variant ID: vg1016341327 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 16341327 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.07, others allele: 0.00, population size: 90. )
CATAATTCAGACTTTTTTCTCGTAGGAAAAAAAAACTATAACAACATGGGCATATATATCGTGTTGTCGTAGCAACTTACTCTCAACTAACCTAACCACA[A/G]
CACAACTGTATTATGATGTATTCTACAGAATAATGCCTTAAAAAAGGATAAATTTTATAGTTCTTAAGAAAGTTTGTGGAGGTGCCAAGATTTTACGCTA
TAGCGTAAAATCTTGGCACCTCCACAAACTTTCTTAAGAACTATAAAATTTATCCTTTTTTAAGGCATTATTCTGTAGAATACATCATAATACAGTTGTG[T/C]
TGTGGTTAGGTTAGTTGAGAGTAAGTTGCTACGACAACACGATATATATGCCCATGTTGTTATAGTTTTTTTTTCCTACGAGAAAAAAGTCTGAATTATG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.30% | 5.90% | 1.99% | 38.81% | NA |
| All Indica | 2759 | 34.40% | 0.40% | 3.01% | 62.20% | NA |
| All Japonica | 1512 | 80.80% | 15.00% | 0.46% | 3.70% | NA |
| Aus | 269 | 82.90% | 14.90% | 0.00% | 2.23% | NA |
| Indica I | 595 | 33.80% | 0.20% | 4.54% | 61.51% | NA |
| Indica II | 465 | 25.60% | 0.20% | 2.58% | 71.61% | NA |
| Indica III | 913 | 37.80% | 0.10% | 2.96% | 59.15% | NA |
| Indica Intermediate | 786 | 36.30% | 0.90% | 2.16% | 60.69% | NA |
| Temperate Japonica | 767 | 87.20% | 11.50% | 0.39% | 0.91% | NA |
| Tropical Japonica | 504 | 89.50% | 6.30% | 0.00% | 4.17% | NA |
| Japonica Intermediate | 241 | 42.30% | 44.40% | 1.66% | 11.62% | NA |
| VI/Aromatic | 96 | 72.90% | 0.00% | 1.04% | 26.04% | NA |
| Intermediate | 90 | 57.80% | 4.40% | 3.33% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1016341327 | A -> G | LOC_Os10g31180.1 | upstream_gene_variant ; 581.0bp to feature; MODIFIER | silent_mutation | Average:24.213; most accessible tissue: Zhenshan97 young leaf, score: 48.658 | N | N | N | N |
| vg1016341327 | A -> G | LOC_Os10g31180-LOC_Os10g31189 | intergenic_region ; MODIFIER | silent_mutation | Average:24.213; most accessible tissue: Zhenshan97 young leaf, score: 48.658 | N | N | N | N |
| vg1016341327 | A -> DEL | N | N | silent_mutation | Average:24.213; most accessible tissue: Zhenshan97 young leaf, score: 48.658 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1016341327 | 8.36E-06 | NA | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016341327 | 7.47E-06 | NA | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016341327 | 2.02E-06 | NA | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016341327 | 5.20E-07 | NA | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016341327 | 1.63E-08 | NA | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016341327 | NA | 5.19E-06 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016341327 | 1.52E-06 | NA | mr1936 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016341327 | 6.44E-08 | NA | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016341327 | NA | 2.03E-06 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016341327 | 5.38E-06 | NA | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016341327 | 2.92E-06 | NA | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016341327 | 7.26E-07 | NA | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016341327 | 6.52E-06 | NA | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016341327 | 3.21E-07 | NA | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016341327 | 3.52E-07 | NA | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016341327 | NA | 7.41E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016341327 | 1.07E-06 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016341327 | 4.15E-06 | NA | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016341327 | 8.35E-09 | NA | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016341327 | NA | 1.11E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |