Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016340773:

Variant ID: vg1016340773 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16340773
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.09, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

CTCCACCTACCGCCCTCGACAATTGCAGTCCCTCCATCCTTGCTTTGCCTTGAAACTGGAGGCGACGGGGGCATGGCACCACGATGGAGACTAAGGGGCT[G/A]
TTTGGATGGGACTAAAATTTTTTTTTCCTATTACATCAGATGTTTGAACACTAATTAGAAGTATTAAATGTAGGCTATTGACAAAATCCATTCATGAGAC

Reverse complement sequence

GTCTCATGAATGGATTTTGTCAATAGCCTACATTTAATACTTCTAATTAGTGTTCAAACATCTGATGTAATAGGAAAAAAAAATTTTAGTCCCATCCAAA[C/T]
AGCCCCTTAGTCTCCATCGTGGTGCCATGCCCCCGTCGCCTCCAGTTTCAAGGCAAAGCAAGGATGGAGGGACTGCAATTGTCGAGGGCGGTAGGTGGAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.70%	7.20%	1.33%	39.78%	NA
All Indica	2759	32.10%	2.30%	2.03%	63.57%	NA
All Japonica	1512	80.70%	15.10%	0.33%	3.90%	NA
Aus	269	82.90%	14.90%	0.00%	2.23%	NA
Indica I	595	33.40%	0.30%	2.35%	63.87%	NA
Indica II	465	22.60%	3.40%	1.72%	72.26%	NA
Indica III	913	35.20%	2.20%	1.75%	60.90%	NA
Indica Intermediate	786	33.10%	3.30%	2.29%	61.32%	NA
Temperate Japonica	767	87.40%	11.50%	0.00%	1.17%	NA
Tropical Japonica	504	89.10%	6.30%	0.60%	3.97%	NA
Japonica Intermediate	241	41.90%	44.80%	0.83%	12.45%	NA
VI/Aromatic	96	66.70%	4.20%	0.00%	29.17%	NA
Intermediate	90	56.70%	4.40%	2.22%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016340773	G -> A	LOC_Os10g31180.1	upstream_gene_variant ; 27.0bp to feature; MODIFIER	silent_mutation	Average:29.846; most accessible tissue: Zhenshan97 young leaf, score: 57.78	N	N	N	N
vg1016340773	G -> A	LOC_Os10g31180-LOC_Os10g31189	intergenic_region ; MODIFIER	silent_mutation	Average:29.846; most accessible tissue: Zhenshan97 young leaf, score: 57.78	N	N	N	N
vg1016340773	G -> DEL	N	N	silent_mutation	Average:29.846; most accessible tissue: Zhenshan97 young leaf, score: 57.78	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016340773	2.79E-07	NA	mr1113	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	5.35E-06	NA	mr1114	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	5.15E-06	NA	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	4.94E-06	NA	mr1117	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	8.46E-06	NA	mr1119	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	5.80E-07	NA	mr1123	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	NA	4.13E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	2.72E-07	NA	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	9.90E-06	NA	mr1247	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	2.71E-08	NA	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	NA	2.99E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	2.91E-06	NA	mr1936	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	1.92E-08	NA	mr1113_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	NA	8.05E-07	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	2.30E-07	NA	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	4.48E-07	NA	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	3.84E-07	NA	mr1119_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	NA	6.59E-06	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	9.37E-06	NA	mr1120_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	1.16E-07	NA	mr1123_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	2.23E-07	NA	mr1240_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	NA	2.49E-06	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	4.93E-08	NA	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	1.66E-06	NA	mr1247_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	3.23E-09	NA	mr1496_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016340773	NA	5.50E-07	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251