\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016339056:

Variant ID: vg1016339056 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16339056
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCCGTTTCATATTATAAGGCTTTCTAGCATATATTGCCAACGTTCATATGTATGTCTAGATTCATTAACATCTTTATAAATATTGGCAATGCTAGAAAG[T/C]
TTTATAATATGAAACAGAGGAAGTATAGTTTGAAATACATCTTTCACCCAAAATGCCAGTGCTCAAATTCCACTATCCTAAAATTTCATTCTCAAATACT

Reverse complement sequence

AGTATTTGAGAATGAAATTTTAGGATAGTGGAATTTGAGCACTGGCATTTTGGGTGAAAGATGTATTTCAAACTATACTTCCTCTGTTTCATATTATAAA[A/G]
CTTTCTAGCATTGCCAATATTTATAAAGATGTTAATGAATCTAGACATACATATGAACGTTGGCAATATATGCTAGAAAGCCTTATAATATGAAACGGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.50% 1.70% 0.89% 40.94% NA
All Indica  2759 34.20% 0.00% 0.36% 65.42% NA
All Japonica  1512 88.60% 5.10% 2.05% 4.23% NA
Aus  269 97.80% 0.00% 0.00% 2.23% NA
Indica I  595 33.40% 0.20% 0.50% 65.88% NA
Indica II  465 25.60% 0.00% 0.43% 73.98% NA
Indica III  913 37.30% 0.00% 0.33% 62.32% NA
Indica Intermediate  786 36.10% 0.00% 0.25% 63.61% NA
Temperate Japonica  767 94.70% 1.40% 2.87% 1.04% NA
Tropical Japonica  504 93.80% 1.20% 0.40% 4.56% NA
Japonica Intermediate  241 58.50% 24.90% 2.90% 13.69% NA
VI/Aromatic  96 71.90% 0.00% 1.04% 27.08% NA
Intermediate  90 58.90% 3.30% 0.00% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016339056 T -> C LOC_Os10g31180.1 intron_variant ; MODIFIER silent_mutation Average:29.095; most accessible tissue: Callus, score: 64.646 N N N N
vg1016339056 T -> DEL N N silent_mutation Average:29.095; most accessible tissue: Callus, score: 64.646 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016339056 9.12E-06 4.63E-07 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 1.47E-07 5.00E-10 mr1114 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 1.57E-06 1.57E-07 mr1116 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 6.92E-08 1.96E-12 mr1117 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 NA 9.71E-10 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 2.80E-07 2.33E-09 mr1119 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 NA 1.13E-06 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 5.39E-06 7.19E-10 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 NA 4.14E-08 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 NA 6.04E-09 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 1.50E-06 3.51E-09 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 6.51E-08 4.02E-12 mr1496 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 NA 2.14E-07 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 NA 1.67E-11 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 NA 6.57E-06 mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 6.81E-06 9.01E-08 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 NA 1.24E-06 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 NA 1.87E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 2.16E-06 1.27E-09 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 3.86E-07 6.26E-10 mr1114_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 3.12E-09 8.19E-14 mr1117_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 3.51E-06 2.95E-10 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 6.74E-09 6.88E-13 mr1119_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 2.03E-07 1.93E-10 mr1120_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 2.29E-07 5.00E-11 mr1123_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 NA 3.28E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 NA 1.56E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 3.18E-09 6.57E-14 mr1240_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 4.22E-07 6.19E-11 mr1242_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 1.23E-07 9.09E-11 mr1247_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 NA 5.80E-08 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 4.47E-10 7.91E-16 mr1496_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 NA 4.82E-08 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016339056 NA 2.59E-06 mr1961_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251