\
| Variant ID: vg1016323870 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 16323870 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GATTAATTATAAGGTTGACTCTATTTTTTCTGAACTCTGTTTTTCTCTCACACTATGAATTTAATGTAATTGTTTTACATCAAGTGGATAACTAACTCTT[G/A]
CGTGAGAGCCAACATTTCTTATCTTTCTCTCTCTTTCACATAATAAGTTTATAGTTGGCTTATAGTTTAGCTACCATATGTATGCACGCTCTTATGCACT
AGTGCATAAGAGCGTGCATACATATGGTAGCTAAACTATAAGCCAACTATAAACTTATTATGTGAAAGAGAGAGAAAGATAAGAAATGTTGGCTCTCACG[C/T]
AAGAGTTAGTTATCCACTTGATGTAAAACAATTACATTAAATTCATAGTGTGAGAGAAAAACAGAGTTCAGAAAAAATAGAGTCAACCTTATAATTAATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.60% | 1.80% | 0.66% | 0.00% | NA |
| All Indica | 2759 | 95.90% | 3.00% | 1.12% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 86.60% | 9.20% | 4.20% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.70% | 2.70% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1016323870 | G -> A | LOC_Os10g31170.1 | intron_variant ; MODIFIER | silent_mutation | Average:29.345; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1016323870 | 1.92E-11 | 1.35E-17 | mr1038 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016323870 | 9.18E-10 | 1.99E-17 | mr1389 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016323870 | NA | 8.85E-07 | mr1571 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016323870 | NA | 4.75E-06 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016323870 | 1.33E-13 | 2.65E-19 | mr1038_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016323870 | 5.70E-09 | NA | mr1141_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016323870 | 8.48E-10 | 1.32E-15 | mr1389_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016323870 | NA | 5.79E-06 | mr1887_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |