\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016277792:

Variant ID: vg1016277792 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16277792
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, A: 0.44, others allele: 0.00, population size: 27. )

Flanking Sequence (100 bp) in Reference Genome:


ACATTTTGTTAAAGAGTTTACTCAAATTTACCAATCAATGACAGTAAATTAATTGGTATAGTCCACATGGCCACCGACACGCACACGTGTACATGTGCAC[A/T]
GCCGAATGCCGATATTGCTGCGCCAAATAGCCTTTTCATAAAAAACAGCTTAAACACACCACACTAACCTTAGCCTCCAACTAATGAGGAGGAAAGAAAC

Reverse complement sequence

GTTTCTTTCCTCCTCATTAGTTGGAGGCTAAGGTTAGTGTGGTGTGTTTAAGCTGTTTTTTATGAAAAGGCTATTTGGCGCAGCAATATCGGCATTCGGC[T/A]
GTGCACATGTACACGTGTGCGTGTCGGTGGCCATGTGGACTATACCAATTAATTTACTGTCATTGATTGGTAAATTTGAGTAAACTCTTTAACAAAATGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.10% 15.60% 0.08% 17.22% NA
All Indica  2759 98.60% 0.70% 0.04% 0.69% NA
All Japonica  1512 6.30% 46.50% 0.13% 47.09% NA
Aus  269 84.80% 0.00% 0.37% 14.87% NA
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 96.80% 2.20% 0.00% 1.08% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.90% 1.30% 0.13% 1.65% NA
Temperate Japonica  767 2.00% 85.40% 0.00% 12.65% NA
Tropical Japonica  504 7.50% 1.20% 0.40% 90.87% NA
Japonica Intermediate  241 17.40% 17.40% 0.00% 65.15% NA
VI/Aromatic  96 72.90% 0.00% 0.00% 27.08% NA
Intermediate  90 63.30% 17.80% 0.00% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016277792 A -> T LOC_Os10g31100.1 upstream_gene_variant ; 395.0bp to feature; MODIFIER silent_mutation Average:50.829; most accessible tissue: Minghui63 root, score: 69.846 N N N N
vg1016277792 A -> T LOC_Os10g31100-LOC_Os10g31110 intergenic_region ; MODIFIER silent_mutation Average:50.829; most accessible tissue: Minghui63 root, score: 69.846 N N N N
vg1016277792 A -> DEL N N silent_mutation Average:50.829; most accessible tissue: Minghui63 root, score: 69.846 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016277792 NA 7.92E-14 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 3.38E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 5.58E-06 mr1029 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 8.14E-16 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 4.85E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 1.83E-16 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 1.16E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 4.98E-24 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 9.62E-31 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 1.98E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 1.60E-42 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 3.66E-12 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 5.70E-09 1.73E-08 mr1530 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 2.18E-09 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 1.72E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 5.53E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 3.39E-24 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 7.55E-28 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 5.27E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 9.35E-07 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 6.16E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 7.43E-31 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 9.97E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 6.88E-07 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 1.37E-12 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 1.30E-23 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 4.55E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 2.34E-14 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 1.63E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 1.53E-09 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016277792 NA 1.94E-13 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251