Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016267177:

Variant ID: vg1016267177 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16267177
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, A: 0.32, others allele: 0.00, population size: 34. )

Flanking Sequence (100 bp) in Reference Genome:

GTGACCAAGTTTAGGCCTTGTTCGGTTTAAAGGGGATTAAAGAGAATTGGAGGGGATTAAGGGGAAATAATTCACACCACAATAGGTGTGGAATAAATCC[A/C]
TTACAATCCTTCCCTCATAAGCATTAACCGAACAAGGTTTTACCGGGATGTTGTGCACGCCGTGCACGGTCCTGTATTGAGAACGACAATAATAGGAGAT

Reverse complement sequence

ATCTCCTATTATTGTCGTTCTCAATACAGGACCGTGCACGGCGTGCACAACATCCCGGTAAAACCTTGTTCGGTTAATGCTTATGAGGGAAGGATTGTAA[T/G]
GGATTTATTCCACACCTATTGTGGTGTGAATTATTTCCCCTTAATCCCCTCCAATTCTCTTTAATCCCCTTTAAACCGAACAAGGCCTAAACTTGGTCAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.20%	15.70%	0.08%	16.99%	NA
All Indica	2759	98.70%	0.60%	0.00%	0.65%	NA
All Japonica	1512	6.30%	46.90%	0.20%	46.56%	NA
Aus	269	84.40%	0.40%	0.37%	14.87%	NA
Indica I	595	99.80%	0.00%	0.00%	0.17%	NA
Indica II	465	97.20%	1.70%	0.00%	1.08%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	97.30%	1.10%	0.00%	1.53%	NA
Temperate Japonica	767	2.00%	85.50%	0.13%	12.39%	NA
Tropical Japonica	504	7.70%	2.20%	0.20%	89.88%	NA
Japonica Intermediate	241	17.40%	17.40%	0.41%	64.73%	NA
VI/Aromatic	96	74.00%	0.00%	0.00%	26.04%	NA
Intermediate	90	63.30%	18.90%	0.00%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016267177	A -> C	LOC_Os10g31090.1	upstream_gene_variant ; 4780.0bp to feature; MODIFIER	silent_mutation	Average:68.47; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg1016267177	A -> C	LOC_Os10g31070-LOC_Os10g31090	intergenic_region ; MODIFIER	silent_mutation	Average:68.47; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg1016267177	A -> DEL	N	N	silent_mutation	Average:68.47; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016267177	NA	3.79E-14	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	5.17E-07	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	4.69E-06	mr1029	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	7.24E-16	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	1.61E-07	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	8.24E-06	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	2.88E-16	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	4.53E-07	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	2.51E-22	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	1.69E-30	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	1.23E-21	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	9.35E-41	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	1.53E-11	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	2.66E-07	1.52E-07	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	7.59E-06	4.55E-10	mr1530	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	1.71E-06	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	9.03E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	5.98E-24	mr1611	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	1.21E-28	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	5.23E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	5.16E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	6.56E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	4.67E-06	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	2.00E-22	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	5.23E-10	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	2.41E-20	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	5.95E-13	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	6.32E-10	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177	NA	6.18E-14	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251