\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016267177:

Variant ID: vg1016267177 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16267177
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, A: 0.32, others allele: 0.00, population size: 34. )

Flanking Sequence (100 bp) in Reference Genome:


GTGACCAAGTTTAGGCCTTGTTCGGTTTAAAGGGGATTAAAGAGAATTGGAGGGGATTAAGGGGAAATAATTCACACCACAATAGGTGTGGAATAAATCC[A/C]
TTACAATCCTTCCCTCATAAGCATTAACCGAACAAGGTTTTACCGGGATGTTGTGCACGCCGTGCACGGTCCTGTATTGAGAACGACAATAATAGGAGAT

Reverse complement sequence

ATCTCCTATTATTGTCGTTCTCAATACAGGACCGTGCACGGCGTGCACAACATCCCGGTAAAACCTTGTTCGGTTAATGCTTATGAGGGAAGGATTGTAA[T/G]
GGATTTATTCCACACCTATTGTGGTGTGAATTATTTCCCCTTAATCCCCTCCAATTCTCTTTAATCCCCTTTAAACCGAACAAGGCCTAAACTTGGTCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.20% 15.70% 0.08% 16.99% NA
All Indica  2759 98.70% 0.60% 0.00% 0.65% NA
All Japonica  1512 6.30% 46.90% 0.20% 46.56% NA
Aus  269 84.40% 0.40% 0.37% 14.87% NA
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 97.20% 1.70% 0.00% 1.08% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 97.30% 1.10% 0.00% 1.53% NA
Temperate Japonica  767 2.00% 85.50% 0.13% 12.39% NA
Tropical Japonica  504 7.70% 2.20% 0.20% 89.88% NA
Japonica Intermediate  241 17.40% 17.40% 0.41% 64.73% NA
VI/Aromatic  96 74.00% 0.00% 0.00% 26.04% NA
Intermediate  90 63.30% 18.90% 0.00% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016267177 A -> C LOC_Os10g31090.1 upstream_gene_variant ; 4780.0bp to feature; MODIFIER silent_mutation Average:68.47; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg1016267177 A -> C LOC_Os10g31070-LOC_Os10g31090 intergenic_region ; MODIFIER silent_mutation Average:68.47; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg1016267177 A -> DEL N N silent_mutation Average:68.47; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016267177 NA 3.79E-14 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 5.17E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 4.69E-06 mr1029 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 7.24E-16 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 1.61E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 8.24E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 2.88E-16 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 4.53E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 2.51E-22 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 1.69E-30 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 1.23E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 9.35E-41 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 1.53E-11 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 2.66E-07 1.52E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 7.59E-06 4.55E-10 mr1530 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 1.71E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 9.03E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 5.98E-24 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 1.21E-28 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 5.23E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 5.16E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 6.56E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 4.67E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 2.00E-22 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 5.23E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 2.41E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 5.95E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 6.32E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016267177 NA 6.18E-14 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251