\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016262709:

Variant ID: vg1016262709 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16262709
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTACGAATATGAATCAATATTTCACACGAACTTCGGGATCGACGCATTTTCACTGCACACACCTATTATCGTCCTCCCTCCTTGTCCTGGATGACTACT[A/C]
CTACAAGGTCAAGGAGCAAGTACAATAGTGCTATAAGCTATAAGCCATTCAAAAATTAGTCTTCTAAGTGCTAAGTATGGAACTAATGTACAAGTAAGAG

Reverse complement sequence

CTCTTACTTGTACATTAGTTCCATACTTAGCACTTAGAAGACTAATTTTTGAATGGCTTATAGCTTATAGCACTATTGTACTTGCTCCTTGACCTTGTAG[T/G]
AGTAGTCATCCAGGACAAGGAGGGAGGACGATAATAGGTGTGTGCAGTGAAAATGCGTCGATCCCGAAGTTCGTGTGAAATATTGATTCATATTCGTAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 15.70% 4.70% 4.70% 74.93% NA
All Indica  2759 0.70% 6.70% 6.20% 86.41% NA
All Japonica  1512 46.60% 0.30% 0.53% 52.58% NA
Aus  269 0.00% 8.60% 14.13% 77.32% NA
Indica I  595 0.00% 3.70% 3.36% 92.94% NA
Indica II  465 1.90% 8.60% 6.24% 83.23% NA
Indica III  913 0.00% 7.90% 9.20% 82.91% NA
Indica Intermediate  786 1.10% 6.60% 4.83% 87.40% NA
Temperate Japonica  767 85.40% 0.00% 0.00% 14.60% NA
Tropical Japonica  504 1.40% 0.60% 0.60% 97.42% NA
Japonica Intermediate  241 17.40% 0.80% 2.07% 79.67% NA
VI/Aromatic  96 2.10% 4.20% 2.08% 91.67% NA
Intermediate  90 20.00% 3.30% 3.33% 73.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016262709 A -> C LOC_Os10g31070.1 upstream_gene_variant ; 2641.0bp to feature; MODIFIER silent_mutation Average:65.814; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg1016262709 A -> C LOC_Os10g31070-LOC_Os10g31090 intergenic_region ; MODIFIER silent_mutation Average:65.814; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg1016262709 A -> DEL N N silent_mutation Average:65.814; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016262709 NA 5.91E-15 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 9.96E-08 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 3.84E-06 mr1029 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 2.04E-06 2.35E-17 mr1031 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 8.86E-09 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 6.29E-07 5.12E-18 mr1056 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 2.05E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 2.84E-23 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 1.69E-29 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 1.38E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 4.84E-22 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 1.44E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 4.09E-43 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 1.22E-12 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 1.19E-08 2.73E-08 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 8.34E-06 2.78E-09 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 2.23E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 6.32E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 5.03E-24 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 2.71E-27 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 1.81E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 8.11E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 3.71E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 2.02E-33 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 5.33E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 1.61E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 7.74E-14 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 1.62E-24 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 3.43E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 8.94E-21 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 1.42E-09 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 1.95E-15 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 1.20E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 6.45E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 1.52E-28 mr1789_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016262709 NA 9.16E-14 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251