\
| Variant ID: vg1016246436 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 16246436 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTCTGTCTAAAGGAAAAAGGATTTAATAATTTATTAAACCCTATTTGGAAAGAAATTGAAGGAGGGATATGATTTAGACTTCCTCGGGTGGCTTGGGTG[C/T]
GGCCCGAGAGGAGAGGCACGGCTCGGCCGAACTAATGGACCGGCCGGCCCGGAGAGGCGGCCCAAGGGGGCGCGGGGAGGGTGAGGGAGAGAGAGGGCCA
TGGCCCTCTCTCTCCCTCACCCTCCCCGCGCCCCCTTGGGCCGCCTCTCCGGGCCGGCCGGTCCATTAGTTCGGCCGAGCCGTGCCTCTCCTCTCGGGCC[G/A]
CACCCAAGCCACCCGAGGAAGTCTAAATCATATCCCTCCTTCAATTTCTTTCCAAATAGGGTTTAATAAATTATTAAATCCTTTTTCCTTTAGACAGAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.10% | 6.80% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 85.60% | 14.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 84.80% | 15.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 89.20% | 10.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 55.60% | 44.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 70.80% | 29.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1016246436 | C -> T | LOC_Os10g31050.1 | downstream_gene_variant ; 3706.0bp to feature; MODIFIER | silent_mutation | Average:54.555; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg1016246436 | C -> T | LOC_Os10g31060.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.555; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1016246436 | 6.84E-06 | NA | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | 3.35E-07 | NA | mr1116 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | 9.09E-07 | NA | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | NA | 2.36E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | 4.80E-07 | NA | mr1119 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | 4.96E-06 | NA | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | NA | 5.83E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | NA | 2.84E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | 9.06E-07 | NA | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | NA | 7.13E-06 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | 4.68E-07 | NA | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | NA | 1.32E-06 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | 5.66E-06 | NA | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | NA | 8.05E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | 3.60E-06 | NA | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | NA | 5.71E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | 9.11E-06 | NA | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | NA | 4.73E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | 5.27E-06 | NA | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | NA | 2.84E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | 2.84E-06 | NA | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016246436 | NA | 6.59E-06 | mr1961_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |