Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016224206:

Variant ID: vg1016224206 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16224206
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

ACCTGTGAAATCAATCATCTCCAAAACCATTTCGTGAATAAATTCTAAATAACAAAACCAATAATCTCCAATGCCCAATTGTTCATCACAGAATAATAAT[C/A]
AAAAACACCTTTGATTTTACATTATTATGGTGTTTGCATGTATCGAACAACTATAAATAATAAATCATAGCTTAATGGATTACACGAAAGTAATTGAACA

Reverse complement sequence

TGTTCAATTACTTTCGTGTAATCCATTAAGCTATGATTTATTATTTATAGTTGTTCGATACATGCAAACACCATAATAATGTAAAATCAAAGGTGTTTTT[G/T]
ATTATTATTCTGTGATGAACAATTGGGCATTGGAGATTATTGGTTTTGTTATTTAGAATTTATTCACGAAATGGTTTTGGAGATGATTGATTTCACAGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.40%	2.30%	1.23%	0.00%	NA
All Indica	2759	94.10%	4.00%	1.96%	0.00%	NA
All Japonica	1512	99.70%	0.10%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	83.00%	10.80%	6.22%	0.00%	NA
Indica II	465	97.80%	1.50%	0.65%	0.00%	NA
Indica III	913	98.80%	1.20%	0.00%	0.00%	NA
Indica Intermediate	786	94.70%	3.60%	1.78%	0.00%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	0.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016224206	C -> A	LOC_Os10g31040.1	upstream_gene_variant ; 1205.0bp to feature; MODIFIER	silent_mutation	Average:39.793; most accessible tissue: Zhenshan97 young leaf, score: 58.398	N	N	N	N
vg1016224206	C -> A	LOC_Os10g31040.5	upstream_gene_variant ; 1207.0bp to feature; MODIFIER	silent_mutation	Average:39.793; most accessible tissue: Zhenshan97 young leaf, score: 58.398	N	N	N	N
vg1016224206	C -> A	LOC_Os10g31030-LOC_Os10g31040	intergenic_region ; MODIFIER	silent_mutation	Average:39.793; most accessible tissue: Zhenshan97 young leaf, score: 58.398	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016224206	NA	4.92E-11	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016224206	2.28E-07	2.06E-07	mr1344	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016224206	NA	1.24E-11	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016224206	3.58E-07	1.12E-08	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016224206	3.41E-06	3.41E-06	mr1544	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016224206	NA	7.98E-06	mr1571	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016224206	NA	7.20E-06	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016224206	NA	4.60E-06	mr1982	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016224206	NA	2.40E-07	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016224206	NA	4.91E-07	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251