Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016196833:

Variant ID: vg1016196833 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16196833
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.60, C: 0.40, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

CAATTTGTGTGCTGCGCTGTATTTTCTAATTGGTGAAAAGAAGTTCGTTGGAGCAATTTGTGGTATACTTGCATACATGCGTTCTTTGTTGTTGCTGACT[A/C]
GTTGCATACGTGGGCAATGATAGAGAGTCGGACTCACGGCACCCACTATGTGATGACGAAGGATAAATACGGGAGGATATATAAGAGTCGGATGTTAAAA

Reverse complement sequence

TTTTAACATCCGACTCTTATATATCCTCCCGTATTTATCCTTCGTCATCACATAGTGGGTGCCGTGAGTCCGACTCTCTATCATTGCCCACGTATGCAAC[T/G]
AGTCAGCAACAACAAAGAACGCATGTATGCAAGTATACCACAAATTGCTCCAACGAACTTCTTTTCACCAATTAGAAAATACAGCGCAGCACACAAATTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.10%	20.90%	0.00%	0.00%	NA
All Indica	2759	99.00%	1.00%	0.00%	0.00%	NA
All Japonica	1512	38.80%	61.20%	0.00%	0.00%	NA
Aus	269	95.50%	4.50%	0.00%	0.00%	NA
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.20%	1.80%	0.00%	0.00%	NA
Temperate Japonica	767	3.80%	96.20%	0.00%	0.00%	NA
Tropical Japonica	504	93.10%	6.90%	0.00%	0.00%	NA
Japonica Intermediate	241	36.90%	63.10%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016196833	A -> C	LOC_Os10g31020.1	upstream_gene_variant ; 1391.0bp to feature; MODIFIER	silent_mutation	Average:54.179; most accessible tissue: Callus, score: 87.015	N	N	N	N
vg1016196833	A -> C	LOC_Os10g31030.1	upstream_gene_variant ; 4417.0bp to feature; MODIFIER	silent_mutation	Average:54.179; most accessible tissue: Callus, score: 87.015	N	N	N	N
vg1016196833	A -> C	LOC_Os10g31020-LOC_Os10g31030	intergenic_region ; MODIFIER	silent_mutation	Average:54.179; most accessible tissue: Callus, score: 87.015	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016196833	NA	5.38E-09	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	5.13E-06	mr1328	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	1.25E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	5.93E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	5.34E-08	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	1.73E-35	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	4.33E-11	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	1.41E-16	mr1540	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	2.34E-06	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	5.60E-22	mr1679	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	1.08E-08	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	1.55E-10	mr1691	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	6.13E-10	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	3.66E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	3.64E-19	mr1732	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	7.59E-09	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	1.90E-10	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	1.34E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	3.58E-12	mr1879	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	1.72E-34	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	1.59E-13	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	3.07E-18	mr1156_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	1.36E-12	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	1.45E-20	mr1308_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	2.09E-32	mr1368_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	6.49E-12	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	1.21E-07	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	2.71E-45	mr1533_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	8.70E-13	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	1.37E-17	mr1539_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	2.26E-14	mr1539_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	5.26E-19	mr1540_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	6.04E-17	mr1540_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	4.75E-08	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	1.83E-18	mr1732_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	8.78E-16	mr1732_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	5.08E-08	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	2.02E-22	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016196833	NA	2.63E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251