\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016195699:

Variant ID: vg1016195699 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16195699
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAACAGATCAAATATGCGCAACATATTGAACATGTACCGAGGTGGCAAAAAGACCGGCTGCTCGGTCGAAACTTTTCGCAGGCGTCTACAAAGGCACGCA[A/G]
CACGCGAGCGAAGAGGAAGACGAGCCGTCGCGGACGAACAGGGAGCAGTCGCGCAAAGCGCTTCCCAAAAACTTTATTGCCGCCTTCTCCCGGTGCGGAA

Reverse complement sequence

TTCCGCACCGGGAGAAGGCGGCAATAAAGTTTTTGGGAAGCGCTTTGCGCGACTGCTCCCTGTTCGTCCGCGACGGCTCGTCTTCCTCTTCGCTCGCGTG[T/C]
TGCGTGCCTTTGTAGACGCCTGCGAAAAGTTTCGACCGAGCAGCCGGTCTTTTTGCCACCTCGGTACATGTTCAATATGTTGCGCATATTTGATCTGTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.50% 0.50% 24.02% 53.00% NA
All Indica  2759 3.40% 0.70% 28.52% 67.31% NA
All Japonica  1512 61.50% 0.10% 7.87% 30.49% NA
Aus  269 5.20% 0.00% 47.58% 47.21% NA
Indica I  595 3.40% 0.00% 12.77% 83.87% NA
Indica II  465 4.10% 0.90% 23.23% 71.83% NA
Indica III  913 2.30% 0.70% 42.28% 54.76% NA
Indica Intermediate  786 4.50% 1.30% 27.61% 66.67% NA
Temperate Japonica  767 96.30% 0.00% 1.69% 1.96% NA
Tropical Japonica  504 7.70% 0.40% 16.27% 75.60% NA
Japonica Intermediate  241 63.10% 0.00% 9.96% 26.97% NA
VI/Aromatic  96 3.10% 0.00% 79.17% 17.71% NA
Intermediate  90 24.40% 0.00% 27.78% 47.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016195699 A -> G LOC_Os10g31020.1 upstream_gene_variant ; 257.0bp to feature; MODIFIER silent_mutation Average:16.377; most accessible tissue: Minghui63 root, score: 27.443 N N N N
vg1016195699 A -> G LOC_Os10g31020-LOC_Os10g31030 intergenic_region ; MODIFIER silent_mutation Average:16.377; most accessible tissue: Minghui63 root, score: 27.443 N N N N
vg1016195699 A -> DEL N N silent_mutation Average:16.377; most accessible tissue: Minghui63 root, score: 27.443 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016195699 NA 5.38E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 5.13E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 1.25E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 5.93E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 5.34E-08 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 4.33E-11 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 1.41E-16 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 2.34E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 8.90E-21 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 1.08E-08 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 9.04E-10 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 1.40E-10 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 3.64E-19 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 2.03E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 6.17E-24 mr1805 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 2.07E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 3.58E-12 mr1879 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 2.38E-30 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 6.49E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 1.29E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 8.70E-13 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 1.30E-18 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 2.26E-14 mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 2.14E-06 1.11E-19 mr1540_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 6.04E-17 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 1.79E-06 7.39E-19 mr1732_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 8.78E-16 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 1.69E-11 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 5.08E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195699 NA 2.63E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251