\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016114306:

Variant ID: vg1016114306 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16114306
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATATGTGCAAATAGTTATTTTTTAGCCTATATTTAATATTTCATGTAGGTGTTCAAACATTCAATGTGATAGGGTGTAAAATTTTAGGGTGGGATCTAA[A/C]
CAGTCCCCCTCAACACATATGAGGGGGGGGGGGGGCAGCCCAACGAAACCTGGAAAAAACAAGCGGTCGTTGGTTAAAAAAAACCTGGTTGGATCGCTTT

Reverse complement sequence

AAAGCGATCCAACCAGGTTTTTTTTAACCAACGACCGCTTGTTTTTTCCAGGTTTCGTTGGGCTGCCCCCCCCCCCCCTCATATGTGTTGAGGGGGACTG[T/G]
TTAGATCCCACCCTAAAATTTTACACCCTATCACATTGAATGTTTGAACACCTACATGAAATATTAAATATAGGCTAAAAAATAACTATTTGCACATATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 2.50% 0.15% 11.81% NA
All Indica  2759 99.40% 0.10% 0.04% 0.47% NA
All Japonica  1512 59.80% 6.50% 0.40% 33.33% NA
Aus  269 95.20% 4.50% 0.00% 0.37% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.90% 0.00% 0.00% 1.08% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 0.30% 0.13% 1.02% NA
Temperate Japonica  767 91.80% 5.30% 0.39% 2.48% NA
Tropical Japonica  504 13.10% 1.00% 0.00% 85.91% NA
Japonica Intermediate  241 55.60% 21.60% 1.24% 21.58% NA
VI/Aromatic  96 74.00% 1.00% 0.00% 25.00% NA
Intermediate  90 80.00% 2.20% 0.00% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016114306 A -> C LOC_Os10g30890.1 upstream_gene_variant ; 2201.0bp to feature; MODIFIER silent_mutation Average:58.545; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg1016114306 A -> C LOC_Os10g30900.1 downstream_gene_variant ; 636.0bp to feature; MODIFIER silent_mutation Average:58.545; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg1016114306 A -> C LOC_Os10g30890-LOC_Os10g30900 intergenic_region ; MODIFIER silent_mutation Average:58.545; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg1016114306 A -> DEL N N silent_mutation Average:58.545; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016114306 NA 1.63E-06 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 5.30E-06 1.14E-08 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 NA 7.61E-07 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 NA 1.10E-08 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 NA 1.39E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 NA 1.87E-07 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 NA 6.00E-09 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 NA 1.15E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 NA 4.48E-08 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 NA 2.34E-08 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 NA 1.08E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 NA 7.96E-07 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 2.74E-06 3.44E-10 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 1.15E-07 1.18E-08 mr1736 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 NA 1.43E-06 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 NA 1.37E-06 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 NA 8.07E-08 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 NA 7.26E-08 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 7.45E-06 2.18E-09 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 NA 4.93E-08 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 2.24E-06 8.14E-10 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 9.14E-06 2.58E-08 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 NA 1.77E-08 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 3.42E-07 2.44E-11 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 7.15E-07 2.04E-10 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 NA 3.36E-08 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 NA 1.38E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 5.23E-07 2.28E-11 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016114306 NA 2.95E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251