\
| Variant ID: vg1016056141 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 16056141 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCAATGTAGCCAAAGCGATTCAAGATCTTCTCCACATAATGGGATTGCAAGTGTGTAATCCCATTTTCACCTCTAATTAGCTTAATGTTTAAGATAACAT[C/T]
AGCTACTCCCAAATCCTTCATATCAAAATTTTGAGACAAGAATGATTTAACCTCATTTATCACCCTAAGATTTGTCCCAAATATCAGTATGTCATCAACA
TGTTGATGACATACTGATATTTGGGACAAATCTTAGGGTGATAAATGAGGTTAAATCATTCTTGTCTCAAAATTTTGATATGAAGGATTTGGGAGTAGCT[G/A]
ATGTTATCTTAAACATTAAGCTAATTAGAGGTGAAAATGGGATTACACACTTGCAATCCCATTATGTGGAGAAGATCTTGAATCGCTTTGGCTACATTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.60% | 0.70% | 2.26% | 39.42% | NA |
| All Indica | 2759 | 56.40% | 1.00% | 1.92% | 40.70% | NA |
| All Japonica | 1512 | 70.80% | 0.30% | 2.71% | 26.12% | NA |
| Aus | 269 | 4.10% | 0.00% | 2.23% | 93.68% | NA |
| Indica I | 595 | 64.70% | 1.30% | 1.01% | 32.94% | NA |
| Indica II | 465 | 70.10% | 0.40% | 2.15% | 27.31% | NA |
| Indica III | 913 | 43.80% | 1.20% | 2.41% | 52.57% | NA |
| Indica Intermediate | 786 | 56.50% | 0.90% | 1.91% | 40.71% | NA |
| Temperate Japonica | 767 | 97.70% | 0.00% | 0.00% | 2.35% | NA |
| Tropical Japonica | 504 | 24.20% | 1.00% | 7.14% | 67.66% | NA |
| Japonica Intermediate | 241 | 83.00% | 0.00% | 2.07% | 14.94% | NA |
| VI/Aromatic | 96 | 30.20% | 0.00% | 0.00% | 69.79% | NA |
| Intermediate | 90 | 62.20% | 1.10% | 7.78% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1016056141 | C -> T | LOC_Os10g30826.1 | missense_variant ; p.Asp310Asn; MODERATE | nonsynonymous_codon ; D310N | Average:11.184; most accessible tissue: Zhenshan97 flower, score: 20.672 | benign |
0.407 |
DELETERIOUS | 0.02 |
| vg1016056141 | C -> DEL | LOC_Os10g30826.1 | N | frameshift_variant | Average:11.184; most accessible tissue: Zhenshan97 flower, score: 20.672 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1016056141 | NA | 4.79E-08 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016056141 | 1.99E-06 | NA | mr1241_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016056141 | NA | 4.50E-06 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016056141 | NA | 9.17E-07 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016056141 | NA | 1.31E-06 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016056141 | NA | 1.38E-09 | mr1771_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016056141 | NA | 9.62E-11 | mr1784_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |