\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016056141:

Variant ID: vg1016056141 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16056141
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAATGTAGCCAAAGCGATTCAAGATCTTCTCCACATAATGGGATTGCAAGTGTGTAATCCCATTTTCACCTCTAATTAGCTTAATGTTTAAGATAACAT[C/T]
AGCTACTCCCAAATCCTTCATATCAAAATTTTGAGACAAGAATGATTTAACCTCATTTATCACCCTAAGATTTGTCCCAAATATCAGTATGTCATCAACA

Reverse complement sequence

TGTTGATGACATACTGATATTTGGGACAAATCTTAGGGTGATAAATGAGGTTAAATCATTCTTGTCTCAAAATTTTGATATGAAGGATTTGGGAGTAGCT[G/A]
ATGTTATCTTAAACATTAAGCTAATTAGAGGTGAAAATGGGATTACACACTTGCAATCCCATTATGTGGAGAAGATCTTGAATCGCTTTGGCTACATTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.60% 0.70% 2.26% 39.42% NA
All Indica  2759 56.40% 1.00% 1.92% 40.70% NA
All Japonica  1512 70.80% 0.30% 2.71% 26.12% NA
Aus  269 4.10% 0.00% 2.23% 93.68% NA
Indica I  595 64.70% 1.30% 1.01% 32.94% NA
Indica II  465 70.10% 0.40% 2.15% 27.31% NA
Indica III  913 43.80% 1.20% 2.41% 52.57% NA
Indica Intermediate  786 56.50% 0.90% 1.91% 40.71% NA
Temperate Japonica  767 97.70% 0.00% 0.00% 2.35% NA
Tropical Japonica  504 24.20% 1.00% 7.14% 67.66% NA
Japonica Intermediate  241 83.00% 0.00% 2.07% 14.94% NA
VI/Aromatic  96 30.20% 0.00% 0.00% 69.79% NA
Intermediate  90 62.20% 1.10% 7.78% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016056141 C -> T LOC_Os10g30826.1 missense_variant ; p.Asp310Asn; MODERATE nonsynonymous_codon ; D310N Average:11.184; most accessible tissue: Zhenshan97 flower, score: 20.672 benign 0.407 DELETERIOUS 0.02
vg1016056141 C -> DEL LOC_Os10g30826.1 N frameshift_variant Average:11.184; most accessible tissue: Zhenshan97 flower, score: 20.672 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016056141 NA 4.79E-08 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016056141 1.99E-06 NA mr1241_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016056141 NA 4.50E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016056141 NA 9.17E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016056141 NA 1.31E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016056141 NA 1.38E-09 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016056141 NA 9.62E-11 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251