Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016045545:

Variant ID: vg1016045545 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16045545
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTTGATGTTTGATGGATGTTGGTTGGAATTGAGTCTATAATAATTATTCAAGGGCATAAACGAATGGATTAAGAGTCACATTTCGGTGCTCTCTACTT[G/A]
TAGTGGAAATCAATCTAAACCGTGTTGATTCTTTTTTATCCAAGAGACTAGATCTATTTATACTACTACCTTATATGCGGTAGTATAAACATAGGAGGAC

Reverse complement sequence

GTCCTCCTATGTTTATACTACCGCATATAAGGTAGTAGTATAAATAGATCTAGTCTCTTGGATAAAAAAGAATCAACACGGTTTAGATTGATTTCCACTA[C/T]
AAGTAGAGAGCACCGAAATGTGACTCTTAATCCATTCGTTTATGCCCTTGAATAATTATTATAGACTCAATTCCAACCAACATCCATCAAACATCAACAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.70%	22.20%	0.06%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.00%	0.00%	NA
All Japonica	1512	33.70%	66.20%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.70%	0.00%	0.00%	NA
Temperate Japonica	767	3.50%	96.30%	0.13%	0.00%	NA
Tropical Japonica	504	81.20%	18.80%	0.00%	0.00%	NA
Japonica Intermediate	241	30.30%	69.30%	0.41%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	72.20%	26.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016045545	G -> A	LOC_Os10g30800.1	upstream_gene_variant ; 293.0bp to feature; MODIFIER	silent_mutation	Average:48.655; most accessible tissue: Callus, score: 75.306	N	N	N	N
vg1016045545	G -> A	LOC_Os10g30800-LOC_Os10g30820	intergenic_region ; MODIFIER	silent_mutation	Average:48.655; most accessible tissue: Callus, score: 75.306	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016045545	NA	3.03E-06	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	1.15E-09	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	2.85E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	5.49E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	7.82E-11	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	3.72E-06	NA	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	6.03E-06	1.68E-08	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	3.66E-15	mr1540	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	2.62E-06	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	8.11E-22	mr1679	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	5.45E-10	mr1691	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	1.95E-09	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	2.62E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	1.34E-17	mr1732	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	5.60E-06	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	6.44E-12	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	2.35E-48	mr1771	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	2.62E-41	mr1784	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	1.55E-11	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	1.00E-09	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	1.23E-06	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	2.16E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	6.88E-24	mr1862	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	2.75E-31	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	1.39E-13	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	2.56E-33	mr1368_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	2.43E-07	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	1.12E-09	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	1.55E-41	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	5.72E-11	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	1.42E-16	mr1540_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	3.94E-15	mr1540_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	2.63E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	2.33E-24	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	4.67E-16	mr1732_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	5.87E-14	mr1732_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	5.93E-27	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	2.44E-40	mr1771_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	6.56E-45	mr1784_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	8.01E-14	mr1800_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	3.03E-07	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	6.52E-08	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	1.63E-20	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016045545	NA	5.41E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251